Direkt zum Inhalt
Merck

EHU113621

Sigma-Aldrich

MISSION® esiRNA

targeting human MEF2C

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGGGTTGATGAAGAAGGCTTATGAGCTGAGCGTGCTGTGTGACTGTGAGATTGCGCTGATCATCTTCAACAGCACCAACAAGCTGTTCCAGTATGCCAGCACCGACATGGACAAAGTGCTTCTCAAGTACACGGAGTACAACGAGCCGCATGAGAGCCGGACAAACTCAGACATCGTGGAGACGTTGAGAAAGAAGGGCCTTAATGGCTGTGACAGCCCAGACCCCGATGCGGACGATTCCGTAGGTCACAGCCCTGAGTCTGAGGACAAGTACAGGAAAATTAACGAAGATATTGATCTAATGATCAGCAGGCAAAGATTGTGTGCTGTTCCACCTCCCAACTTCGAGATGCCAGTCTCCATCCCAGTGTCCAGCCACAACAGTTTGGTGTACAGCAACCCTGTCAGCTCACT

Ensembl | Human Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Mingliang Bai et al.
EMBO reports, 21(11), e50283-e50283 (2020-10-06)
A microdeletion within human chromosome 5q14.3 has been associated with the occurrence of neurodevelopmental disorders, such as autism and intellectual disability, and MEF2C haploinsufficiency was identified as main cause. Here, we report that a brain-enriched long non-coding RNA, NDIME, is located
Aleksandra Deczkowska et al.
Nature communications, 8(1), 717-717 (2017-09-30)
During ageing, microglia acquire a phenotype that may negatively affect brain function. Here we show that ageing microglial phenotype is largely imposed by interferon type I (IFN-I) chronically present in aged brain milieu. Overexpression of IFN-β in the CNS of
Hong-Ping Chen et al.
Journal of cellular physiology, 234(12), 23315-23325 (2019-05-30)
MicroRNAs (miRNAs) is a small molecule (19-25 nucleotide) noncoding RNA that inhibits the expression of target messenger RNA (mRNA) at the posttranscriptional level as an endogenous regulator. There is an increasing evidence that miR-199a-3p has a significant effect on the
Jing-Jing Zhang et al.
Molecular cancer, 13, 130-130 (2014-06-03)
Increasing evidence indicates an important role of transcription factor Yin Yang-1 (YY1) in human tumorigenesis. However, its function in cancer remains controversial and the relevance of YY1 to pancreatic ductal adenocarcinoma (PDAC) remains to be clarified. In this study, we
Jung-Hwa Han et al.
Life sciences, 135, 1-8 (2015-06-03)
bFGF is a potent mitogen of cells associated with fibrosis. Although ERK5 has been reported to play roles in the development of fibrosis, its roles in regulating bFGF-induced fibrotic responses are not understood, especially in lung fibroblasts. The authors investigated

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.