Direkt zum Inhalt
Merck

EHU107771

Sigma-Aldrich

MISSION® esiRNA

targeting human IFITM1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TTGGTCCCTGGCTAATTCACCAATTTACAAACAGCAGGAAATAGAAACTTAAGAGAAATACACACTTCTGAGAAACTGAAACGACAGGGGAAAGGAGGTCTCACTGAGCACCGTCCCAGCATCCGGACACCACAGCGGCCCTTCGCTCCACGCAGAAAACCACACTTCTCAAACCTTCACTCAACACTTCCTTCCCCAAAGCCAGAAGATGCACAAGGAGGAACATGAGGTGGCTGTGCTGGGGCCACCCCCCAGCACCATCCTTCCAAGGTCCACCGTGATCAACATCCACAGCGAGACCTCCGTGCCCGACCATGTCGTCTGGTCCCTGTTCAACACCCTCTTCTTGAACTGGTGCTGTCTGGGCTTCATAGCATTCGCCTACTCCGTGAAGTCTAGGGACAGGAAGATGGTTGGCGACGTGACCGGGGCCCAGGCCTATGCCTCCACCGCCAAGTGCCTGAACATCTGGGCCCTGATTCTGGGCATCCTCAT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Hosni A M Hussein et al.
Scientific reports, 7(1), 17972-17972 (2017-12-23)
Kaposi's sarcoma-associated herpesvirus (KSHV) is etiologically associated with all forms of Kaposi's sarcoma worldwide. Little is currently known about the role of microRNAs (miRNAs) in KSHV entry. We recently demonstrated that KSHV induces a plethora of host cell miRNAs during
Hosni A M Hussein et al.
Scientific reports, 8(1), 14105-14105 (2018-09-22)
The oncogenic gammaherpesviruses, Epstein-Barr virus (EBV) and Kaposi's sarcoma herpesvirus (KSHV), are etiologically associated with a variety of human cancers, including Burkitt's lymphoma (BL), Hodgkin lymphoma (HL), Kaposi's sarcoma (KS), and primary effusion lymphoma (PEL). Recently, we demonstrated KSHV infection
Bo Feng et al.
Virology journal, 14(1), 213-213 (2017-11-05)
Endothelial cells are believed to play an important role in response to virus infection. Our previous microarray analysis showed that H9N2 virus infection and inactivated viral particle inoculation increased the expression of interferon-inducible transmembrane protein 1 (IFITM1) in human umbilical
Ying-Ying Xu et al.
Cancer research and treatment : official journal of Korean Cancer Association, 51(2), 576-592 (2018-07-22)
Although the interferon α (IFNα) signaling and the paired-like homeodomain transcription factor 2 (PITX2) have both been implicated in the progression of breast cancer (BCa), it remains obscure whether these two pathways act in a coordinated manner. We therefore aimed

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.