Direkt zum Inhalt
Merck

EHU095021

Sigma-Aldrich

MISSION® esiRNA

targeting human NELL1 (1)

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GTGCCGTGCATTTAAGTCAATGGTTGTTAAAAGAAGTTTCCCGTGTTGTAAATCATGTTTCCCTTATCAGATCATTTGCAAATACATTTAAATGATCTCATGGTAAATGTTGATGTATTTTTTGGTTTATTTTGTGTACTAACATAATAGAGAGAGACTCAGCTCCTTTTATTTATTTTGTTGATTTATGGATCAAATTCTAAAATAAAGTTGCCTGTTGTGACTTTTGTCCCATCTACTGCATACTTAGTGCTGAGATCCCTGTAAAATGTTTTGATGAAAATATGTATGTAGAGTCCAGTCGCATTATACATACATTTCATAGTGCTGAACCTTCTTAAATGCC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Juan Cong Dong et al.
Journal of cellular and molecular medicine, 19(9), 2286-2295 (2015-07-07)
The purpose of this study was to determine the correlation between over-expression of the neuropilin 1 (NRP1) gene and growth, survival, and radio-sensitivity of non-small cell lung carcinoma (NSCLC) cells. 3-[4,5-dimethylthylthiazol-2-yl]-2,5 diphenyltetrazolium broide (MTT) and colony assays were then performed
Anthony Ambesi et al.
Journal of cell science, 127(Pt 17), 3805-3816 (2014-07-02)
The fibronectin matrix plays a crucial role in the regulation of angiogenesis during development, tissue repair and pathogenesis. Previous work has identified a fibronectin-derived homophilic binding peptide, anastellin, as an effective inhibitor of angiogenesis; however, its mechanism of action is
Claudio Raimondi et al.
The Journal of experimental medicine, 211(6), 1167-1183 (2014-05-28)
To enable new blood vessel growth, endothelial cells (ECs) express neuropilin 1 (NRP1), and NRP1 associates with the receptor tyrosine kinase VEGFR2 after binding the vascular endothelial growth factor A (VEGF) to enhance arteriogenesis. We report that NRP1 contributes to
Hong-Bo Pang et al.
Nature communications, 5, 4904-4904 (2014-10-04)
Neuropilins (NRPs) are trans-membrane receptors involved in axon guidance and vascular development. Many growth factors and other signalling molecules bind to NRPs through a carboxy (C)-terminal, basic sequence motif (C-end Rule or CendR motif). Peptides with this motif (CendR peptides)

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.