Direkt zum Inhalt
Merck
Alle Fotos(1)

Wichtige Dokumente

EHU094011

Sigma-Aldrich

MISSION® esiRNA

targeting human ITPR1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

100

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGCTGACCTGAGGAGTGAGAAGCAGAAGAAGGAAGAGATCTTGAAGACCACGTGCTTTATCTGTGGCTTGGAAAGAGACAAGTTTGACAACAAGACTGTCACCTTTGAAGAGCACATCAAGGAAGAACACAACATGTGGCACTATCTGTGCTTCATCGTCCTGGTGAAAGTAAAGGACTCCACCGAATATACTGGGCCTGAGAGTTACGTGGCAGAAATGATCAAGGAAAGAAACCTTGACTGGTTCCCCAGGATGAGAGCCATGTCATTGGTCAGCAGTGATTCTGAAGGAGAACAGAATGAGCTGAGAAACCTGCAGGAGAAGCTGGAGTCCACCATGAAACTTGTCACGAACCTTTCTGGCCAGCTGTCGGAATTAAAGGATCAGATGACAGAACAAAGGAAGCAGAAACAAAGAATTGG

Ensembl | Human Hinterlegungsnummer

ENSG00000150995

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... ITPR1(3708) , ITPR1(3708)

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Jie Tong et al.
Biochimica et biophysica acta, 1864(12), 2389-2401 (2017-10-01)
The mechanism by which cell shape regulates the function of the cell is one of the most important biological issues, but it remains unclear. Here, we investigated the effect of the regulation of cell shape on proliferation by using a
Ting Yu et al.
Experimental cell research, 399(2), 112438-112438 (2020-12-29)
Palmitic acid (PA)-induced hepatocyte apoptosis is critical for the progression of nonalcoholic fatty liver disease (NAFLD). Inositol 1,4,5-trisphosphate receptor type 1 (IP3R1) is an intracellular Ca2+-release channel and is involved in PA-induced hepatocyte apoptosis. While the expression of IP3R1 is
Yi-Dong Yang et al.
Journal of cellular biochemistry, 120(11), 18967-18978 (2019-06-27)
Mitochondrial dysfunction plays a principal role in hypoxia-induced endothelial injury, which is involved in hypoxic pulmonary hypertension and ischemic cardiovascular diseases. Recent studies have identified mitochondria-associated membranes (MAMs) that modulate mitochondrial function under a variety of pathophysiological conditions such as high-fat diet-mediated
Raul Lagos-Cabré et al.
Cell reports, 33(11), 108483-108483 (2020-12-17)
The mitotic spindle distributes chromosomes evenly to daughter cells during mitosis. The orientation of the spindle, guided by internal and external cues, determines the axis of cell division and thereby contributes to tissue morphogenesis. Progression through mitosis requires local Ca2+
Vishal R Yadav et al.
American journal of physiology. Lung cellular and molecular physiology, 314(5), L724-L735 (2018-02-02)
Hypoxia-induced pulmonary vasoconstriction (HPV) is attributed to an increase in intracellular Ca2+ concentration ([Ca2+]i) in pulmonary artery smooth muscle cells (PASMCs). We have reported that phospholipase C-γ1 (PLCγ1) plays a significant role in the hypoxia-induced increase in [Ca2+]i in PASMCs
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.