Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU091961

Sigma-Aldrich

MISSION® esiRNA

targeting human FLI1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

100

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ATGACCACCAACGAGAGGAGAGTCATCGTCCCCGCAGACCCCACACTGTGGACACAGGAGCATGTGAGGCAATGGCTGGAGTGGGCCATAAAGGAGTACAGCTTGATGGAGATCGACACATCCTTTTTCCAGAACATGGATGGCAAGGAACTGTGTAAAATGAACAAGGAGGACTTCCTCCGCGCCACCACCCTCTACAACACGGAAGTGCTGTTGTCACACCTCAGTTACCTCAGGGAAAGTTCACTGCTGGCCTATAATACAACCTCCCACACCGACCAATCCTCACGATTGAGTGTCAAAGAAGACCCTTCTTATGACTCAGTCAGAAGAGGAGCTTGGGGCAATAACATGAATTCTGGCCTCAACAAAAGTCCTCCCCTTGGAGGGGCACAAACGATCAGTAAGAATACAGAGCAACGGCC

Ensembl | Human Hinterlegungsnummer

ENSG00000151702

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... FLI1(2313) , FLI1(2313)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Tao He et al.
Gene, 596, 137-146 (2016-10-30)
A translocation leading to the formation of an oncogenic EWS-ETS fusion protein defines Ewing sarcoma. The most frequent gene fusion, present in 85 percent of Ewing sarcomas, is EWS-FLI1. Here, a high-throughput RNA interference screen was performed to identify genes
Gong-Hong Wei et al.
The EMBO journal, 29(13), 2147-2160 (2010-06-03)
Members of the large ETS family of transcription factors (TFs) have highly similar DNA-binding domains (DBDs)-yet they have diverse functions and activities in physiology and oncogenesis. Some differences in DNA-binding preferences within this family have been described, but they have
T Miyagawa et al.
Journal of the European Academy of Dermatology and Venereology : JEADV, 33(4), 753-760 (2018-12-07)
Trappin-2/pre-elafin is an endogenous inhibitor of human neutrophil elastase involved in inflammation, innate immunity and vascular remodelling, which consist of the complex pathological process of systemic sclerosis (SSc). To clarify the potential role of trappin-2 in SSc. Serum trappin-2 levels
Jonathan P Van Beek et al.
Arthritis research & therapy, 8(2), R36-R36 (2006-02-14)
CCN2 is encoded by an immediate-early gene induced in mesenchymal cells during the formation of blood vessels, bone and connective tissue. It plays key roles in cell adhesion and migration, as well as matrix remodeling. CCN2 is overexpressed in fibrosis
Samer Kayali et al.
PloS one, 7(10), e46799-e46799 (2012-10-12)
Clonal erythroleukemia developing in susceptible mice infected by Friend virus complex are associated with highly recurrent proviral insertions at one of three loci called Spi-1, Fli-1 or Fli-3, leading to deregulated expression of oncogenic Spi-1 or Fli-1 transcription factors or
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.