Direkt zum Inhalt
Merck

EHU091861

Sigma-Aldrich

MISSION® esiRNA

targeting human ENG

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CATGCAGATCTGGACCACTGGAGAATACTCCTTCAAGATCTTTCCAGAGAAAAACATTCGTGGCTTCAAGCTCCCAGACACACCTCAAGGCCTCCTGGGGGAGGCCCGGATGCTCAATGCCAGCATTGTGGCATCCTTCGTGGAGCTACCGCTGGCCAGCATTGTCTCACTTCATGCCTCCAGCTGCGGTGGTAGGCTGCAGACCTCACCCGCACCGATCCAGACCACTCCTCCCAAGGACACTTGTAGCCCGGAGCTGCTCATGTCCTTGATCCAGACAAAGTGTGCCGACGACGCCATGACCCTGGTACTAAAGAAAGAGCTTGTTGCGCATTTGAAGTGCACCATCACGGGCCTGACCTTCTGGGACCCCAGCTGTGAGGCAGAGGACAGGGGTGACAAGTTTGTCTTGCGCAGTGCTTACT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Shoumei Bai et al.
Cancers, 11(11) (2019-11-07)
: Most high-grade serous ovarian cancers (HGSCs) initiate from the fallopian tube epithelium and then metastasize to the ovary and throughout the abdomen. Genomic analyses suggest that most HGSCs seed the ovary prior to abdominal dissemination. Similarly, animal models support
Elisa Rossi et al.
Cellular and molecular life sciences : CMLS, 73(8), 1715-1739 (2015-12-10)
The circulatory system is walled off by different cell types, including vascular mural cells and podocytes. The interaction and interplay between endothelial cells (ECs) and mural cells, such as vascular smooth muscle cells or pericytes, play a pivotal role in
Krishnendu Pal et al.
Molecular cancer therapeutics, 13(10), 2264-2275 (2014-08-16)
Endoglin, a 180-kDa disulfide-linked homodimeric transmembrane receptor protein mostly expressed in tumor-associated endothelial cells, is an endogenous binding partner of GAIP-interacting protein, C terminus (GIPC). Endoglin functions as a coreceptor of TβRII that binds TGFβ and is important for vascular
Priyanka Singh et al.
Cancer research, 78(11), 2978-2989 (2018-03-15)
Inhibin is a heterodimeric TGFβ family ligand that is expressed in many cancers and is a selective biomarker for ovarian cancers; however, its tumor-specific functions remain unknown. Here, we demonstrate that the α subunit of inhibin (INHA), which is critical
Caixia Yuan et al.
Experimental and therapeutic medicine, 17(4), 2547-2556 (2019-03-25)
Bone morphogenetic protein (BMP) expression has been observed in the uterus in previous studies. However, the influence of BMP7 on blastocyst implantation remains unclear. Blastocysts first act on luminal endometrial epithelial cells during implantation. The purpose of the present study

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.