Direkt zum Inhalt
Merck

EHU091841

Sigma-Aldrich

MISSION® esiRNA

targeting human INSR

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AAGTGCATCCCTGAGTGTCCCTCCGGGTACACGATGAATTCCAGCAACTTGCTGTGCACCCCATGCCTGGGTCCCTGTCCCAAGGTGTGCCACCTCCTAGAAGGCGAGAAGACCATCGACTCGGTGACGTCTGCCCAGGAGCTCCGAGGATGCACCGTCATCAACGGGAGTCTGATCATCAACATTCGAGGAGGCAACAATCTGGCAGCTGAGCTAGAAGCCAACCTCGGCCTCATTGAAGAAATTTCAGGGTATCTAAAAATCCGCCGATCCTACGCTCTGGTGTCACTTTCCTTCTTCCGGAAGTTACGTCTGATTCGAGGAGAGACCTTGGAAATTGGGAACTACTCCTTCTATGCCTTGGACAACCAGAACCTAAGGCAGCTCTGGGACTGGAGCAAACACAACCTCACCATCACTCAGGG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Zheqi Li et al.
Endocrinology, 159(1), 285-296 (2017-10-14)
Increased evidence suggests that somatic mutations in the ligand-binding domain of estrogen receptor [ER (ERα/ESR1)] are critical mediators of endocrine-resistant breast cancer progression. Insulinlike growth factor-1 (IGF1) is an essential regulator of breast development and tumorigenesis and also has a
Phoebe L Sarkar et al.
Frontiers in endocrinology, 10, 481-481 (2019-08-06)
Androgen deprivation therapy (ADT) is the standard treatment for advanced prostate cancer (PCa), yet many patients relapse with lethal metastatic disease. With this loss of androgens, increased cell plasticity has been observed as an adaptive response to ADT. This includes
Sandip Mukherjee et al.
PloS one, 12(1), e0169809-e0169809 (2017-01-11)
Dramatic increase of diabetes over the globe is in tandem with the increase in insulin requirement. This is because destruction and dysfunction of pancreatic β-cells are of common occurrence in both Type1 diabetes and Type2 diabetes, and insulin injection becomes
Oscar Escribano et al.
Molecular and cellular endocrinology, 409, 82-91 (2015-03-24)
The main compensatory response to insulin resistance is the pancreatic beta cell hyperplasia to account for increased insulin secretion. In fact, in a previous work we proposed a liver-pancreas endocrine axis with IGF-I (insulin-like growth factor type I) secreted by
Shingo Ito et al.
Neurochemistry international, 101, 22-29 (2016-11-05)
We have previously shown in SH-SY5Y human neuroblastoma cells that the expressions of basal (75 kDa) and high molecular weight (HMW; 85 kDa) isoforms of the p75 neurotrophic receptor (p75NTR) are stimulated by amyloid-β peptide1-42 oligomers (AβOs) via the insulin-like growth factor-1

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.