Direkt zum Inhalt
Merck

EHU090371

Sigma-Aldrich

MISSION® esiRNA

targeting human CDH1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CAGCACGTACACAGCCCTAATCATAGCTACAGACAATGGTTCTCCAGTTGCTACTGGAACAGGGACACTTCTGCTGATCCTGTCTGATGTGAATGACAACGCCCCCATACCAGAACCTCGAACTATATTCTTCTGTGAGAGGAATCCAAAGCCTCAGGTCATAAACATCATTGATGCAGACCTTCCTCCCAATACATCTCCCTTCACAGCAGAACTAACACACGGGGCGAGTGCCAACTGGACCATTCAGTACAACGACCCAACCCAAGAATCTATCATTTTGAAGCCAAAGATGGCCTTAGAGGTGGGTGACTACAAAATCAATCTCAAGCTCATGGATAACCAGAATAAAGACCAAGTGACCACCTTAGAGGTCAGCGTGTGTGACTGTGAAGGGGCCGCTGGCGTCTGTAGGAAGGCACAGCCT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Anchalee Techasen et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 35(9), 8645-8652 (2014-05-29)
Tumor progression is characterized by loss of cell adhesion and increase of invasion and metastasis. E-cadherin, a cell adhesion molecule, is frequently downregulated and has been proposed as an important mediator in epithelial-mesenchymal transition (EMT) in tumors. In this study
Branka Petrić Miše et al.
Pathology oncology research : POR, 21(2), 347-356 (2014-08-12)
To analyze correlation between immunoexpression of E-cadherin and efficacy of first line platinum-based chemotherapy in patients with advanced-stage high-grade serous ovarian carcinoma. The expression of E-cadherin was analyzed immunohistochemically in formalin-fixed, paraffin-embedded samples from 98 patients with advanced-stage high-grade serous
Vikas Bhardwaj et al.
Oncotarget, 6(3), 1531-1543 (2015-01-22)
H. pylori infection is the strongest known risk factor for gastric cancer. Inhibition of host tumor suppressor mechanisms by the bacteria underlies the development of this disease. Among the tumor suppressors affected by H. pylori are p53 and E-cadherin, which
Shuai Xiao et al.
Digestive diseases and sciences, 60(4), 910-918 (2014-11-05)
Epithelial-mesenchymal transition (EMT) plays an important role in hepatocellular carcinoma (HCC) dissemination. Bromodomain PHD-finger transcription factor (BPTF) could regulate embrogenesis and stem cell differentiation, and it may be involved in tumor progression and EMT. In this study, we aimed to
Alex Chernyavsky et al.
International immunopharmacology, 29(1), 76-80 (2015-05-24)
The mechanism of detachment and death of keratinocytes in pemphigus vulgaris (PV) involves pro-apoptotic action of constellations of autoantibodies determining disease severity and response to treatment. The presence of antibodies to nicotinic acetylcholine receptors (nAChRs) and the therapeutic efficacy of

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.