Direkt zum Inhalt
Merck

EHU081851

Sigma-Aldrich

MISSION® esiRNA

targeting human ANGPT2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GTGACTGCCACGGTGAATAATTCAGTTCTTCAGAAGCAGCAACATGATCTCATGGAGACAGTTAATAACTTACTGACTATGATGTCCACATCAAACTCAGCTAAGGACCCCACTGTTGCTAAAGAAGAACAAATCAGCTTCAGAGACTGTGCTGAAGTATTCAAATCAGGACACACCACGAATGGCATCTACACGTTAACATTCCCTAATTCTACAGAAGAGATCAAGGCCTACTGTGACATGGAAGCTGGAGGAGGCGGGTGGACAATTATTCAGCGACGTGAGGATGGCAGCGTTGATTTTCAGAGGACTTGGAAAGAATATAAAGTGGGATTTGGTAACCCTTCAGGAGAATATTGGCTGGGAAATGAGTTTGTTTCGCAACTGACTAATCAGCAACGCTATGTGCTTAAAATACACCTTAAAGACTGGGAAGGG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Mi-Lan Kang et al.
Journal of cellular biochemistry, 118(9), 2896-2908 (2017-02-19)
Our previous studies revealed that co-transplantation of bone marrow stem cells (BMSCs) and adipose-derived stem cells (ADSCs) can enhance bone regeneration and angiogenesis. However, it is unclear which genes are involved in the regulation of osteogenesis and/or angiogenesis during the
Jing Xu et al.
American journal of physiology. Cell physiology, 313(3), C262-C273 (2017-06-24)
Angiopoietin-2 (Ang-2) contributes to vascular hyporeactivity after hemorrhagic shock and hypoxia through upregulation of inducible nitric oxide synthase (iNOS) in a vascular endothelial cell (VEC)-specific and Ang-2/Tie2 receptor-dependent manner. While iNOS is primarily expressed in vascular smooth muscle cells (VSMCs)
Don Yuen et al.
Investigative ophthalmology & visual science, 55(5), 3320-3327 (2014-05-02)
Lymphatic research has progressed rapidly in recent years. Lymphatic dysfunction has been found in myriad disorders from cancer metastasis to transplant rejection; however, effective treatment for lymphatic disorders is still limited. This study investigates the role of angiopoietin-2 (Ang-2) in
Changqing Luo et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 34(3), 916-928 (2014-09-10)
To investigate the role of angiopoietin-2 (Ang-2) and IL-18 in the pathogenesis of diabetic nephropathy (DN) and the molecular mechanisms through which alprostadil protects renal function. DN was induced by streptozotocin and intraperitoneal injection of alprostadil was given to diabetic

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.