Direkt zum Inhalt
Merck

EHU080501

Sigma-Aldrich

MISSION® esiRNA

targeting human ARHGAP4

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GCTTGATTCCTTCCAGACCAGCCCCTCCACCGAGTCCCTCAAGTCCACCAGCTCAGACCCAGGCAGCCGGCAGGCGGGCCGGAGGCGCGGCCAGCAGCAGGAGACCGAAACCTTCTACCTCACGAAGCTCCAGGAGTATCTGAGTGGACGGAGCATCCTCGCCAAGCTGCAGGCCAAGCACGAGAAGCTGCAGGAGGCCCTTCAGCGAGGTGACAAGGAGGAGCAGGAGGTGTCTTGGACCCAGTACACACAGAGAAAATTCCAGAAGAGCCGCCAGCCCCGCCCCAGCTCCCAGTATAACCAGAGACTCTTTGGGGGAGACATGGAGAAGTTTATCCAGAGCTCAGGCCAGCCTGTGCCCCTGGTGGTGGAGAGCTGCATTCGCTTCATCAACCTCAATGGCC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

P-S Hu et al.
Oncogene, 36(33), 4706-4718 (2017-04-11)
Polycomb group (PcG) proteins play an important role in development and stem cell maintenance, and their dysregulation have been closely linked to oncogenesis and cancer stem cell phenotypes. Here, we found that nervous system polycomb 1 (NSPc1) was highly expressed
Dabin Lee et al.
Cell death & disease, 9(5), 495-495 (2018-05-03)
Chemokine CCL4 (MIP-1β) is released from osteoblast cells to restore the homeostasis of hematopoietic stem cells during the activation of bone marrow. In this study, we investigated the function of CCL4 and its receptor CCR5 during osteoclastogenesis. CCL4 promoted the
Yehua Shen et al.
Carcinogenesis, 40(11), 1405-1414 (2019-04-09)
β-catenin is a subunit of the cadherin protein complex and acts as an intracellular signal transducer in the Wnt signaling pathway that mediates multiple cellular processes, such as cell migration and invasion. HDAC2 (histone deacetylase 2), a deacetylase that maintains
Yehua Shen et al.
OncoTargets and therapy, 12, 5003-5012 (2019-07-16)
The phenomenon that cancer cells avidly exhibit glycolysis with lactate secretion and decrease in mitochondrial activity under aerobic conditions is known historically as the Warburg effect. Rho GTPase-activating protein 4 (ARHGAP4) is an important negative regulator of the Rho signaling
Y-B Yu et al.
Acta physiologica (Oxford, England), 219(2), 465-477 (2016-05-28)
Erythropoietin (EPO), the key hormone involved in erythropoiesis, beneficially affects endothelial cells (ECs), but the detailed mechanisms are yet to be completely understood. In this study, we investigated the role of transient receptor potential vanilloid type 1 (TRPV1), a ligand-gated

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.