Direkt zum Inhalt
Merck

EHU079781

Sigma-Aldrich

MISSION® esiRNA

targeting human EPHB4

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TATTCGGACAAACACGGACAGTATCTCATCGGACATGGTACTAAGGTCTACATCGACCCCTTCACTTATGAAGACCCTAATGAGGCTGTGAGGGAATTTGCAAAAGAGATCGATGTCTCCTACGTCAAGATTGAAGAGGTGATTGGTGCAGGTGAGTTTGGCGAGGTGTGCCGGGGGCGGCTCAAGGCCCCAGGGAAGAAGGAGAGCTGTGTGGCAATCAAGACCCTGAAGGGTGGCTACACGGAGCGGCAGCGGCGTGAGTTTCTGAGCGAGGCCTCCATCATGGGCCAGTTCGAGCACCCCAATATCATCCGCCTGGAGGGCGTGGTCACCAACAGCATGCCCGTCATGATTCTCACAGAGTTCATGGAGAACGGCGCCCTGGACTCCTTCCTGCGGCTAAAC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Man Zhu et al.
Cell death & disease, 11(8), 632-632 (2020-08-18)
Overexpressed EphB4 conduce to tumor development and is regarded as a potential anticancer target. Homoharringtonine (HHT) has been approved for hematologic malignancies treatment, but its effect on hepatocellular carcinoma (HCC) has not been studied. This study elucidated HHT could restrain
Shilpa Bhatia et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 24(18), 4539-4550 (2018-06-01)
Purpose: The clinical success of targeted therapies such as cetuximab and radiotherapy (RT) is hampered by the low response rates and development of therapeutic resistance. In the current study, we investigated the involvement of EphB4-ephrin-B2 protumorigenic signaling in mediating resistance
Xiuqing Li et al.
PloS one, 9(8), e105326-e105326 (2014-08-26)
Effective treatment of transitional cell carcinoma (TCC) of the bladder requires early diagnosis. Identifying novel molecular markers in TCC would guide the development of diagnostic and therapeutic targets. Ephrins mediate signals via tyrosine kinase activity that modulates diverse physiologic and
Thao M Nguyen et al.
Stem cells (Dayton, Ohio), 33(9), 2838-2849 (2015-06-03)
The tyrosine kinase receptor, EphB4, mediates cross-talk between stromal and hematopoietic populations during bone remodeling, fracture repair and arthritis, through its interactions with the ligand, ephrin-B2. This study demonstrated that transgenic EphB4 mice (EphB4 Tg), over-expressing EphB4 under the control
Inga Mertens-Walker et al.
Experimental cell research, 333(1), 105-115 (2015-03-01)
The EphB4 receptor tyrosine kinase is over-expressed in a variety of different epithelial cancers including prostate where it has been shown to be involved in survival, migration and angiogenesis. We report here that EphB4 also resides in the nucleus of

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.