Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU078571

Sigma-Aldrich

MISSION® esiRNA

targeting human CYLD

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

100

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CAGCCTCCTCCTGTGAACTCACTGACCACCGAGAACAGATTCCACTCTTTACCATTCAGTCTCACCAAGATGCCCAATACCAATGGAAGTATTGGCCACAGTCCACTTTCTCTGTCAGCCCAGTCTGTAATGGAAGAGCTAAACACTGCACCCGTCCAAGAGAGTCCACCCTTGGCCATGCCTCCTGGGAACTCACATGGTCTAGAAGTGGGCTCATTGGCTGAAGTTAAGGAGAACCCTCCTTTCTATGGGGTAATCCGTTGGATCGGTCAGCCACCAGGACTGAATGAAGTGCTCGCTGGACTGGAACTGGAAGATGAGTGTGCAGGCTGTACGGATGGAACCTTCAGAGGCACTCGGTATTTCACCTGTGCCCTGAAGAAGGCGCTGTTTGTGAAACTGAAGAGCTGCAGGCCTGACTCTAGGTTTGCATCATTGCAGC

Ensembl | Human Hinterlegungsnummer

ENSG00000083799

NCBI-Hinterlegungsnummer

NM_001042355

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... CYLD(1540) , CYLD(1540)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Tadaatsu Imaizumi et al.
Kidney & blood pressure research, 42(5), 942-950 (2017-11-23)
Cylindromatosis (CYLD), a deubiquitinase, negatively regulates nuclear factor-κB in various cells. However, its potential roles in glomerular inflammation remain unclear. Because the activation of the Toll-like receptor 3 (TLR3)/type I interferon (IFN) pathways plays a pivotal role in chronic kidney
Suruchi N Schock et al.
Cell death and differentiation, 24(4), 615-625 (2017-01-07)
Necroptosis is a form of necrotic cell death that requires the activity of the death domain-containing kinase RIP1 and its family member RIP3. Necroptosis occurs when RIP1 is deubiquitinated to form a complex with RIP3 in cells deficient in the
Yuki Imaizumi et al.
Biochemical and biophysical research communications, 508(4), 1168-1174 (2018-12-18)
Cardiovascular disease is one of the leading causes of death in the elderly, and novel therapeutic targets against atherogenesis are urgent. The initiation of atherosclerotic changes of monocyte adhesion on the vascular endothelium and subsequent foam cell formation are noteworthy
Ming Zhao et al.
Cancer medicine, 9(3), 1196-1208 (2019-12-21)
According to the global cancer statistic, lung cancer is one of the most dangerous tumors, which poses a serious threat to human health. Exploration the mechanism of lung cancer and new targeted therapeutic measures is always the hot topic. Long
Kensei Komatsu et al.
Journal of immunology (Baltimore, Md. : 1950), 204(4), 933-942 (2020-01-05)
Otitis media (OM) is the most common bacterial infection in children. It remains a major health problem and a substantial socioeconomic burden. Streptococcus pneumoniae (S. pneumoniae) is one of the most common bacterial pathogens causing OM. Innate inflammatory response plays
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.