Direkt zum Inhalt
Merck

EHU077831

Sigma-Aldrich

MISSION® esiRNA

targeting human HOXA9

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ATGCACCCATTGTGATTGTGGAAGATAGAATTCAATTTGAACTCAGGTTGTTTATGAGGGGAAAAAAACAGTTGCATAGAGTATAGCTCTGTAGTGGAATATGTCTTCTGTATAACTAGGCTGTTAACCTATGATTGTAAAGTAGCTGTAAGAATTTCCCAGTGAAATAAAAAAAAATTTTAAGTGTTCTCGGGGATGCATAGATTCATCATTTTCTCCACCTTAAAAATGCGGGCATTTAAGTCTGTCCATTATCTATATAGTCCTGTCTTGTCTATTGTATATATAATCTATATGATTAAAGAAAATATGCATAATCAGACAAGCTTGAATATTGTTTTTGCACCAGACGAACAGTGAGGAAATTCGGAGCTATACATATGTGCAGAAGGTTACTACCTAGGGTTTATGCTTAATTTTAATTGGAGGAAATGAATGCTGA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Xiaoping Liu et al.
Placenta, 51, 38-48 (2017-03-16)
Functional placenta formation is crucially dependent on extravillous trophoblast migration and invasion. EPHB4 has been identified to play a negative but important role in regulating trophoblast biological function, whereas the upstream regulation mechanism remains unknown. As reported, there is a
Jun Ni et al.
Journal of receptor and signal transduction research, 39(5-6), 399-406 (2019-12-27)
Purpose: To investigate the possible mechanism of miR-210 involved in epithelial-mesenchymal transition (EMT) of pancreatic cancer cells under hypoxia. Methods: In this study, we used the following approaches. Hypoxic microenvironment was stimulated in vitro, and the CCK-8 assay was used to
Seong-Lan Yu et al.
Molecular carcinogenesis, 55(12), 1915-1926 (2015-11-21)
MicroRNAs (miRNAs) are recognized as crucial posttranscriptional regulators of gene expression, and play critical roles as oncogenes or tumor suppressors in various cancers. Here, we show that miR-196b is upregulated in mesenchymal-like-state non-small cell lung cancer (NSCLC) cells and lung
Yilin Liu et al.
International journal of oncology, 54(5), 1809-1820 (2019-03-01)
Several microRNAs (miRNAs or miRs) that regulate a variety of cancer‑related events are dysregulated in osteosarcoma (OS). An exploration of the specific roles of miRNAs in OS is crucial for the identification of suitable therapeutic targets. Previous studies have shown that

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.