Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU076761

Sigma-Aldrich

MISSION® esiRNA

targeting human EGFR

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TAACAAGCTCACGCAGTTGGGCACTTTTGAAGATCATTTTCTCAGCCTCCAGAGGATGTTCAATAACTGTGAGGTGGTCCTTGGGAATTTGGAAATTACCTATGTGCAGAGGAATTATGATCTTTCCTTCTTAAAGACCATCCAGGAGGTGGCTGGTTATGTCCTCATTGCCCTCAACACAGTGGAGCGAATTCCTTTGGAAAACCTGCAGATCATCAGAGGAAATATGTACTACGAAAATTCCTATGCCTTAGCAGTCTTATCTAACTATGATGCAAATAAAACCGGACTGAAGGAGCTGCCCATGAGAAATTTACAGGAAATCCTGCATGGCGCCGTGCGGTTCAGCAACAACCCTGCCCTGTGCAACGTGGAGAGCATCCAGTGGCGGGACATAGTCAGCAGTGACTTTCTCAGCAACATGTCGATGGACTTCCAGAACCAC

Ensembl | Human Hinterlegungsnummer

ENSG00000146648

NCBI-Hinterlegungsnummer

NM_005228

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... EGFR(1956) , EGFR(1956)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Meifang Li et al.
Journal of experimental & clinical cancer research : CR, 38(1), 211-211 (2019-05-24)
Epidermal growth factor receptor (EGFR) and epidermal growth factor receptor pathway substrate 8 (Eps8) have been widely reported to be expressed in various tumors. Eps8 is an important active kinase substrate of EGFR that directly binds to the juxtamembrane (JXM)
Yi-Yang Peng et al.
Biomacromolecules, 19(10), 4052-4058 (2018-08-31)
Strong signaling cascades derived from upregulation and overexpression of growth factors such as the EGF-family (epidermal growth factors) have been crucially related to cancer pathogenesis. Gene silencing techniques to modulate the expression of oncogenes and tumor suppresor genes are a
Katia Rea et al.
Journal of experimental & clinical cancer research : CR, 37(1), 146-146 (2018-07-13)
The disruption of E-cadherin-mediated adhesion is considered an important driver of tumor progression. Nevertheless, numerous studies have demonstrated that E-cadherin promotes growth- or invasion-related signaling, contrary to the prevailing notion. During tumor progression, epithelial ovarian cancer (EOC) maintains E-cadherin expression
Ijeoma Adaku Umelo et al.
Lung cancer (Amsterdam, Netherlands), 90(2), 167-174 (2015-09-08)
Lung cancer remains the leading cause of cancer-related mortality worldwide, with metastatic disease frequently a prominent feature at the time of diagnosis. The role of NSCLC-derived EGFR mutations in cancer cell proliferation and survival has been widely reported, but little
Jia Shen et al.
Journal of experimental & clinical cancer research : CR, 37(1), 157-157 (2018-07-19)
Lycorine has been revealed to inhibit the development of many kinds of malignant tumors, including glioblastoma multiforme (GBM). Although compelling evidences demonstrated Lycorine's inhibition on cancers through some peripheral mechanism, in-depth mechanism studies of Lycotine's anti-GBM effects still call for
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.