Direkt zum Inhalt
Merck

EHU073951

Sigma-Aldrich

MISSION® esiRNA

targeting human PAK4

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GCGAGTATCCCATGAGCAGTTCCGGGCTGCCCTGCAGCTGGTGGTGGACCCAGGCGACCCCCGCTCCTACCTGGACAACTTCATCAAGATTGGCGAGGGCTCCACGGGCATCGTGTGCATCGCCACCGTGCGCAGCTCGGGCAAGCTGGTGGCCGTCAAGAAGATGGACCTGCGCAAGCAGCAGAGGCGCGAGCTGCTCTTCAACGAGGTGGTAATCATGAGGGACTACCAGCACGAGAATGTGGTGGAGATGTACAACAGCTACCTGGTGGGGGACGAGCTCTGGGTGGTCATGGAGTTCCTGGAAGGAGGCGCCCTCACCGACATCGTCACCCACACCAGGATGAACGAGGAGCAGATCGCGGCCGTGTGCCTTGCAGTGCTGCAGGCCCTGTCGGTGCTCCACGCCCAGGGCGTCATCCACCGGGACATCAAGAGCGACTCGATCC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Shi-Xun Lu et al.
Cancer letters, 402, 71-80 (2017-06-05)
The dysregulation of transcription factors contributes to the unlimited growth of cancer cells. Zic2 has been shown to be crucial to the progression of human cancers. However, its role in hepatocellular carcinoma (HCC) remains unclear. Our data showed that Zic2
Xianghe Lu et al.
Oncology reports, 38(2), 1240-1250 (2017-07-06)
Glioma is an extremely aggressive and lethal type of brain tumour that originates from glial cells. MicroRNA (miRNA) dysregulation has been implicated in the occurrence and progression of many human cancers, including glioma. Thus, some specific miRNAs are potential therapeutic
Amro Aboukameel et al.
Molecular cancer therapeutics, 16(1), 76-87 (2017-01-08)
The p21-activated kinase 4 (PAK4) is a key downstream effector of the Rho family GTPases and is found to be overexpressed in pancreatic ductal adenocarcinoma (PDAC) cells but not in normal human pancreatic ductal epithelia (HPDE). Gene copy number amplification
Helen King et al.
Scientific reports, 7, 42575-42575 (2017-02-17)
It has been reported that p21-activated kinase 4 (PAK4) is amplified in pancreatic cancer tissue. PAK4 is a member of the PAK family of serine/threonine kinases, which act as effectors for several small GTPases, and has been specifically identified to
Na Li et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 25(1), 369-377 (2018-09-13)
p21-activated kinase 4 (PAK4) plays a significant biological and functional role in a number of malignancies, including multiple myeloma (MM). On the basis of our promising findings in MM, we here characterize PAK4 expression and role in WM cells, as

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.