Direkt zum Inhalt
Merck

EHU073641

Sigma-Aldrich

MISSION® esiRNA

targeting human ARNTL

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGGAGGGACTCCAGACATTCCTTCCAGTGGCCTACTATCAGGCCAGGCTCAGGAGAACCCAGGTTATCCATATTCTGATAGTTCTTCTATTCTTGGTGAGAACCCCCACATAGGTATAGACATGATTGACAACGACCAAGGATCAAGTAGTCCCAGTAATGATGAGGCAGCAATGGCTGTCATCATGAGCCTCTTGGAAGCAGATGCTGGACTGGGTGGCCCTGTTGACTTTAGTGACTTGCCATGGCCGCTGTAAACACTACATGTTGCTTTGGCAACAGCTATAGTATCAAAGTGCATTACTGGTGGAGTTTTACAGTCTGTGAAGCTTACTGGATAAGGAGAGAATAGCTTTTATGTACTGACTTCATAAAAGCCATCTCAGAGCCATTGATACAAGTCAATCTTACTATATGTAACTTCAGACAAAGTGGAACTAAGCCTGCTCCA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Whitney Sussman et al.
American journal of physiology. Cell physiology, 317(3), C492-C501 (2019-06-20)
The transcription factor aryl hydrocarbon receptor nuclear translocator-like protein-1 (BMAL1) is an essential regulator of the circadian clock, which controls the 24-h cycle of physiological processes such as nutrient absorption. To examine the role of BMAL1 in small intestinal glucose
Panshak P Dakup et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(2), 3347-3358 (2020-01-11)
Radiation therapy (RT) is commonly used to treat solid tumors of the breast, lung, and esophagus; however, the heart is an unintentional target of ionizing radiation (IR). IR exposure to the heart results in chronic toxicities including heart failure. We
Silke Kiessling et al.
BMC biology, 15(1), 13-13 (2017-02-16)
Circadian clocks control cell cycle factors, and circadian disruption promotes cancer. To address whether enhancing circadian rhythmicity in tumor cells affects cell cycle progression and reduces proliferation, we compared growth and cell cycle events of B16 melanoma cells and tumors
Nikolai Genov et al.
Scientific reports, 9(1), 11062-11062 (2019-08-01)
The circadian clock regulates key cellular processes and its dysregulation is associated to several pathologies including cancer. Although the transcriptional regulation of gene expression by the clock machinery is well described, the role of the clock in the regulation of
Rukeia El-Athman et al.
PLoS biology, 15(12), e2002940-e2002940 (2017-12-08)
The mammalian circadian clock and the cell cycle are two major biological oscillators whose coupling influences cell fate decisions. In the present study, we use a model-driven experimental approach to investigate the interplay between clock and cell cycle components and

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.