Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU069501

Sigma-Aldrich

MISSION® esiRNA

targeting human SMAD2 (2)

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TTCCGCCTCTGGATGACTATACTCACTCCATTCCAGAAAACACTAACTTCCCAGCAGGAATTGAGCCACAGAGTAATTATATTCCAGAAACGCCACCTCCTGGATATATCAGTGAAGATGGAGAAACAAGTGACCAACAGTTGAATCAAAGTATGGACACAGGCTCTCCAGCAGAACTATCTCCTACTACTCTTTCCCCTGTTAATCATAGCTTGGATTTACAGCCAGTTACTTACTCAGAACCTGCATTTTGGTGTTCGATAGCATATTATGAATTAAATCAGAGGGTTGGAGAAACCTTCCATGCATCACAGCCCTCACTCACTGTAGATGGCTTTACAGACCCATCAAATTCAGAGAGGTTCTGCTTAGGTTTACTCTCCAATGTTAACCGAAATGCCACGGTAGAAAT

Ensembl | Human Hinterlegungsnummer

ENSG00000175387

NCBI-Hinterlegungsnummer

NM_005901

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... SMAD2(4087) , SMAD2(4087)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Ping Zhao et al.
Cancer chemotherapy and pharmacology, 84(2), 427-439 (2019-05-16)
Although DNA-mismatch-repair-deficient (dMMR) status and aberrant expression of miRNAs are both critically implicated in the pathogenesis of resistance to 5-fluorouracil (5-FU) in colorectal cancer (CRC), whether these two factors regulate tumor response to 5-FU in a coordinated manner remains unknown.
Qingde Wa et al.
Oncology reports, 39(1), 81-90 (2017-11-16)
Constitutive activation of TGF‑β signaling pathway is a well-documented mechanism responsible for the bone metastasis of prostate cancer (PCa). MicroRNAs (miRNAs) have been reported to be crucial for the activation of TGF‑β signaling via targeting downstream components of TGF‑β signaling
Wei Zhang et al.
Journal of Cancer, 12(6), 1678-1686 (2021-02-23)
Circular RNAs (circRNAs) are associated with various diseases, including cancers. However, their roles in colorectal cancer (CRC) have not been established. Hsa_circ_0000847 (circ_SMAD2) is a novel circRNA that was found to be elevated in CRC cell lines and tissues. High
Benjamin V Park et al.
Cancer discovery, 6(12), 1366-1381 (2016-09-30)
Programmed death-1 (PD-1) is a coinhibitory receptor that downregulates the activity of tumor-infiltrating lymphocytes (TIL) in cancer and of virus-specific T cells in chronic infection. The molecular mechanisms driving high PD-1 expression on TILs have not been fully investigated. We
Ayesha Ghayur et al.
American journal of physiology. Renal physiology, 317(1), F152-F162 (2019-05-30)
Glomerulonephritis (GN) is a common cause of end-stage kidney disease and is characterized by glomerular inflammation, hematuria, proteinuria, and progressive renal dysfunction. Transforming growth factor (TGF)-β is involved in glomerulosclerosis and interstitial fibrosis. TGF-β activates multiple signaling pathways, including the
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.