Direkt zum Inhalt
Merck

EHU068161

Sigma-Aldrich

MISSION® esiRNA

targeting human CD47

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GGCCTCTGGCCTCTAGGTAACCAGTTTAAATTGGTTCAGGGTGATAACTACTTAGCACTGCCCTGGTGATTACCCAGAGATATCTATGAAAACCAGTGGCTTCCATCAAACCTTTGCCAACTCAGGTTCACAGCAGCTTTGGGCAGTTATGGCAGTATGGCATTAGCTGAGAGGTGTCTGCCACTTCTGGGTCAATGGAATAATAAATTAAGTACAGGCAGGAATTTGGTTGGGAGCATCTTGTATGATCTCCGTATGATGTGATATTGATGGAGATAGTGGTCCTCATTCTTGGGGGTTGCCATTCCCACATTCCCCCTTCAACAAACAGTGTAACAGGTCCTTCCCAGATTTAGGGTACTTTTATTGATGGATATGTTTTCCTTTTATTCACATAACCCCTTGAAACCCTG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Xifu Song et al.
Experimental and therapeutic medicine, 20(4), 3301-3309 (2020-08-29)
Treatment with cluster of differentiation 47 (CD47) monoclonal antibody has exhibited promising antitumor effects in various preclinical cancer models. However, its role in pancreatic ductal adenocarcinoma (PDAC) remains unclear. In the present study, the CD47 expression level was measured in
Xuejian Liu et al.
Oncology research, 27(4), 415-422 (2018-01-13)
Cluster of differentiation 47 (CD47) overexpression is common in various malignancies. This study investigated whether CD47 promotes human glioblastoma invasion and, if so, the underlying mechanisms involved. CD47 expression was found to be stronger in tissues of patients with glioblastoma
Natasha M Rogers et al.
Kidney international, 90(2), 334-347 (2016-06-05)
Defects in renal tubular epithelial cell repair contribute to renal ischemia reperfusion injury, cause acute kidney damage, and promote chronic renal disease. The matricellular protein thrombospondin-1 and its receptor CD47 are involved in experimental renal ischemia reperfusion injury, although the
Hui Zhao et al.
Scientific reports, 6, 29719-29719 (2016-07-15)
CD47 is overexpressed in many human cancers, its level positively correlates with tumor invasion and metastasis. However, it is largely unknown whether CD47 overexpression drives metastasis and how CD47 lead to tumor metastasis in non-small cell lung cancer (NSCLC). In
Thies Rösner et al.
Molecular cancer therapeutics, 18(1), 75-88 (2018-10-05)
Three FDA-approved epidermal growth factor receptor (EGFR) antibodies (cetuximab, panitumumab, necitumumab) are clinically available to treat patients with different types of cancers. Interestingly, panitumumab is of human IgG2 isotype, which is often considered to have limited immune effector functions. Unexpectedly

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.