Direkt zum Inhalt
Merck
Alle Fotos(1)

Wichtige Dokumente

EHU067421

Sigma-Aldrich

MISSION® esiRNA

targeting human LRP1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

100

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGCTACTGCAACAGCAGCTTTCAGCTTCAGGCAGATGGCAAGACCTGCAAAGATTTTGATGAGTGCTCAGTGTACGGCACCTGCAGCCAGCTATGCACCAACACAGACGGCTCCTTCATATGTGGCTGTGTTGAAGGATACCTCCTGCAGCCGGATAACCGCTCCTGCAAGGCCAAGAACGAGCCAGTAGACCGGCCCCCTGTGCTGTTGATAGCCAACTCCCAGAACATCTTGGCCACGTACCTGAGTGGGGCCCAGGTGTCTACCATCACACCTACGAGCACGCGGCAGACCACAGCCATGGACTTCAGCTATGCCAACGAGACCGTATGCTGGGTGCATGTTGGGGACAGTGCTGCTCAGACGCAGCTCAAGTGTGCCCGCATGCCTGGCCTAAAGGGCTTCGTGGATGAG

Ensembl | Human Hinterlegungsnummer

ENSG00000123384

NCBI-Hinterlegungsnummer

NM_002332

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... LRP1(4035) , LRP1(4035)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Ling Lin et al.
Oncotarget, 8(50), 88094-88103 (2017-11-21)
Macrophage accumulation is one of the hallmarks of progressive kidney disease. In response to injury, macrophages undergo a phenotypic polarization to become two functionally distinct subsets: M1 and M2 macrophages. Macrophage polarization is a dynamic process, and recent work indicates
Paola Merino et al.
The Journal of biological chemistry, 292(7), 2741-2753 (2016-12-18)
Axonal injury is a common cause of neurological dysfunction. Unfortunately, in contrast to axons from the peripheral nervous system, the limited capacity of regeneration of central nervous system (CNS) axons is a major obstacle for functional recovery in patients suffering
Jianhua Peng et al.
Redox biology, 21, 101121-101121 (2019-02-01)
White matter injury (WMI) is associated with motor deficits and cognitive dysfunctions in subarachnoid hemorrhage (SAH) patients. Therapeutic strategy targeting WMI would likely improve the neurological outcomes after SAH. Low-density lipoprotein receptor-related protein-1 (LRP1), a scavenger receptor of apolipoprotein E
Aline Appert-Collin et al.
Cell adhesion & migration, 11(4), 316-326 (2016-07-28)
The low-density lipoprotein receptor-related protein-1 (LRP-1) is a member of Low Density Lipoprotein Receptor (LDLR) family, which is ubiquitously expressed and which is described as a multifunctional endocytic receptor which mediates the clearance of various extracellular matrix molecules including serine
Masayuki Nakano et al.
Disease models & mechanisms, 9(12), 1473-1481 (2016-12-10)
Helicobacter pylori, a major cause of gastroduodenal diseases, produces vacuolating cytotoxin (VacA) and cytotoxin-associated gene A (CagA), which seem to be involved in virulence. VacA exhibits pleiotropic actions in gastroduodenal disorders via its specific receptors. Recently, we found that VacA
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.