Direkt zum Inhalt
Merck

EHU067201

Sigma-Aldrich

MISSION® esiRNA

targeting human AKT3

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CAGTGGCAAAATGCCAGTTAATGAAAACAGAACGACCAAAGCCAAACACATTTATAATCAGATGTCTCCAGTGGACTACTGTTATAGAGAGAACATTTCATGTAGATACTCCAGAGGAAAGGGAAGAATGGACAGAAGCTATCCAGGCTGTAGCAGACAGACTGCAGAGGCAAGAAGAGGAGAGAATGAATTGTAGTCCAACTTCACAAATTGATAATATAGGAGAGGAAGAGATGGATGCCTCTACAACCCATCATAAAAGAAAGACAATGAATGATTTTGACTATTTGAAACTACTAGGTAAAGGCACTTTTGGGAAAGTTATTTTGGTTCGAGAGAAGGCAAGTGGAAAATACTATGCTATGAAGATTCTGAAGAAAGAAGTCATTATTGCAAAGGATGAAGTGGCACAC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Guo-Qing Sui et al.
American journal of cancer research, 7(5), 1177-1187 (2017-06-01)
microRNA-338-3p (miR-338-3p) has been implicated in tumor development and progression in many types of cancers. However, the function and mechanism underlying the action of miR-383-3p in thyroid cancer remain unclear and were therefore investigated in this study by
Kohji Noguchi et al.
The Journal of biological chemistry, 292(5), 1910-1924 (2016-12-29)
The suppression of mitotic Aurora kinases (AURKs) by AURK inhibitors frequently causes cytokinetic failure, leading to polyploidy or aneuploidy, indicating the critical role of AURK-mediated phosphorylation during cytokinesis. We demonstrate the deregulated expression of AKT3 in Aurora kinase inhibitor (AURKi)-resistant
Nikolaus A Watson et al.
Nature communications, 11(1), 1684-1684 (2020-04-05)
There are thousands of known cellular phosphorylation sites, but the paucity of ways to identify kinases for particular phosphorylation events remains a major roadblock for understanding kinase signaling. To address this, we here develop a generally applicable method that exploits
Jade Peres et al.
Oncotarget, 6(3), 1821-1833 (2015-01-18)
The AKT3 signalling pathway plays a critical role in melanoma formation and invasion and components of this signalling cascade are therefore attractive targets for the treatment of malignant melanoma. Recent evidence show that the embryonically important TBX3 transcription factor is

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.