Direkt zum Inhalt
Merck
Alle Fotos(1)

Wichtige Dokumente

EHU064831

Sigma-Aldrich

MISSION® esiRNA

targeting human IFT88

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

100

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ATTATGAGAAGGCCGCTGAATTCTATAAAGAGGCTCTAAGAAATGATTCTTCTTGTACTGAAGCACTTTATAATATTGGCCTTACCTATGAGAAACTAAATCGGCTAGATGAGGCTTTGGACTGTTTCCTGAAACTTCACGCAATCCTACGAAACAGTGCCGAAGTTCTTTACCAGATAGCAAATATATATGAATTAATGGAAAATCCCAGTCAAGCTATTGAATGGCTAATGCAGGTGGTCAGTGTTATTCCAACCGATCCTCAAGTTTTATCTAAGCTAGGAGAATTATATGATCGTGAAGGAGATAAATCTCAAGCATTTCAATATTACTATGAGTCATATAGGTATTTTCCTTGTAATATTGAAGTCATTGAGTGGCTTGGAGCCTATTACATTGACACCCAATTTTGGGA

Ensembl | Human Hinterlegungsnummer

ENSG00000032742

NCBI-Hinterlegungsnummer

NM_175605

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... IFT88(8100) , IFT88(8100)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Qike Huang et al.
Cancer letters, 402, 52-60 (2017-05-26)
Determining the origin of liver cancer stem cells is important for treating hepatocellular carcinoma. Tg737 deficiency plays an important role in the malignant transformation of liver stem cells, but the underlying mechanism remains unclear. Here we established a chemical-induced mouse
Matthew E Deren et al.
International journal of molecular sciences, 17(2), 188-188 (2016-02-11)
Chondroprogenitors and hypertrophic chondrocytes, which are the first and last stages of the chondrocyte differentiation process, respectively, are sensitive to mechanical signals. We hypothesize that the mechanical sensitivity of these cells depends on the cell surface primary cilia. To test
Daolu Zhan et al.
Molecular medicine reports, 16(5), 6590-6599 (2017-09-14)
Intraflagellar transport protein 88 (IFT88) is protein crucial for the assembly and maintenance of primary cilia in chondrocytes. Primary cilia regulate mechanical and chemical signals in chondrocytes; however, the effects of cytokines on IFT88 expression and cilia formation and maintenance
Chia-Yih Wang et al.
The Journal of physiology, 597(12), 3069-3083 (2019-04-27)
Endocrine gland-derived vascular endothelial growth factor (EG-VEGF) is a critical factor that facilitates trophoblast invasion in placenta. Plasma miR-141 and miR-200a levels were elevated, while EG-VEGF was decreased in peripheral blood and placenta of preeclamptic patients. Furthermore, numbers of cilia
Wengui Shi et al.
Scientific reports, 7(1), 1866-1866 (2017-05-14)
It is well documented that microgravity in space environment leads to bone loss in astronauts. These physiological changes have also been validated by human and animal studies and modeled in cell-based analogs. However, the underlying mechanisms are elusive. In the
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.