Direkt zum Inhalt
Merck

EHU063551

Sigma-Aldrich

MISSION® esiRNA

targeting human CUL3

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AGTGATGCACTGCCTTGACAAATCAACGGAAGAACCAATTGTAAAGGTGGTTGAAAGGGAACTCATTTCCAAGCACATGAAGACTATAGTAGAAATGGAGAATTCTGGGCTAGTACATATGTTGAAAAATGGAAAGACAGAAGACCTTGGTTGCATGTACAAGTTATTTAGTCGTGTGCCAAATGGTTTGAAAACAATGTGTGAGTGTATGAGTTCCTATTTGAGGGAGCAAGGTAAAGCTCTTGTTTCTGAAGAAGGAGAAGGAAAGAATCCTGTTGACTATATCCAGGGCTTATTGGATCTGAAGAGTAGGTTCGATCGCTTCCTCCTGGAATCATTCAACAATGACCGTCTCTTTAAACAAACTATTGCGGGTGACTTTGAGTATTTTCTCAACCTCAACTCCAGGTCTCCTG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Tomohisa Sakaue et al.
Cancer science, 108(2), 208-215 (2016-12-18)
Vascular endothelial (VE)-cadherin, a major endothelial adhesion molecule, regulates vascular permeability, and increased vascular permeability has been observed in several cancers. The aim of this study was to elucidate the role of the NEDD8-Cullin E3 ligase, in maintaining barrier permeability.
Tomohisa Sakaue et al.
Scientific reports, 7, 42845-42845 (2017-02-22)
Vascular endothelial cell growth factor receptor 2 (VEGFR2) is an essential receptor for the homeostasis of endothelial cells. In this study, we showed that NEDD8-conjugated Cullin3 (CUL3)-based ubiquitin E3 (UbE3) ligase plays a crucial role in VEGFR2 mRNA expression. Human
Alexandros P Drainas et al.
Cell reports, 31(1), 107465-107465 (2020-04-09)
TP53 deficiency is the most common alteration in cancer; however, this alone is typically insufficient to drive tumorigenesis. To identify genes promoting tumorigenesis in combination with TP53 deficiency, we perform genome-wide CRISPR-Cas9 knockout screens coupled with proliferation and transformation assays
Antonio Pisano et al.
The Journal of biological chemistry, 290(22), 13958-13971 (2015-04-18)
The human inhibitor of Bruton's tyrosine kinase isoform α (IBtkα) is a BTB protein encoded by the IBTK gene, which maps to chromosomal locus 6q14.1, a mutational hot spot in lymphoproliferative disorders. Here, we demonstrate that IBtkα forms a CRL3(IBTK)
Qian Zhang et al.
Reproduction (Cambridge, England), 150(2), 139-149 (2015-05-30)
Cullin 3 (CUL3), a scaffold protein, assembles a large number of ubiquitin ligase complexes, similar to Skp1-Cullin 1-F-box protein complex. Several genetic models have shown that CUL3 is crucial for early embryonic development. Nevertheless, the role of CUL3 in human

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.