Direkt zum Inhalt
Merck

EHU056051

Sigma-Aldrich

MISSION® esiRNA

targeting human SPTA1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCTTGTTGCCTCTGAAGGACTGTTTCACAGTCACAAGGGACTTGAGAGAAATCTTGCTGTCATGAGTGACAAGGTGAAGGAGTTATGTGCTAAAGCAGAGAAGCTGACACTTTCCCATCCTTCAGATGCACCTCAGATCCAGGAGATGAAAGAAGATCTGGTCTCCAGCTGGGAGCATATTCGTGCCCTGGCCACCAGCAGATATGAAAAACTGCAGGCTACTTATTGGTACCATCGATTTTCATCTGACTTTGATGAACTCTCAGGCTGGATGAACGAGAAGACTGCTGCGATCAATGCTGATGAGCTGCCAACAGATGTGGCTGGTGGAGAAGTTCTGCTGGACAGGCATCAGCAGCATAAGCATGAGATTGACTCTTACGATGACCGATTTCAATCTGCTGATGAGACTGGTCAAGACCTCGTGAATGCCAATCATGAAGCCTC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

N C Hait et al.
Oncogenesis, 4, e156-e156 (2015-06-09)
Estrogen receptor-α (ERα)-negative breast cancer is clinically aggressive and does not respond to conventional hormonal therapies. Strategies that lead to re-expression of ERα could sensitize ERα-negative breast cancers to selective ER modulators. FTY720 (fingolimod, Gilenya), a sphingosine analog, is the
T H Beckham et al.
Oncogenesis, 2, e49-e49 (2013-06-05)
Acid ceramidase (AC) is overexpressed in most prostate tumors and confers oncogenic phenotypes to prostate cancer cells. AC modulates the cellular balance between ceramide, sphingosine and sphingosine 1-phosphate (S1P). These bioactive sphingolipids have diverse, powerful and often oppositional impacts on
Evgeny V Berdyshev et al.
PloS one, 6(1), e16571-e16571 (2011-02-10)
Earlier we have shown that extracellular sphingosine-1-phosphate (S1P) induces migration of human pulmonary artery endothelial cells (HPAECs) through the activation of S1P(1) receptor, PKCε, and PLD2-PKCζ-Rac1 signaling cascade. As endothelial cells generate intracellular S1P, here we have investigated the role
Yunze Xu et al.
Oncotarget, 7(3), 3233-3244 (2015-12-18)
Adrenocortical carcinoma (ACC) is a rare endocrine tumor with a very poor prognosis. Sphingosine kinase 1 (SphK1), an oncogenic kinase, has previously been found to be upregulated in various cancers. However, the role of the SphK1 in ACC has not
Panfeng Fu et al.
The Journal of biological chemistry, 291(53), 27187-27203 (2016-11-20)
Hepatocyte growth factor (HGF) signaling via c-Met is known to promote endothelial cell motility and angiogenesis. We have previously reported that HGF stimulates lamellipodia formation and motility of human lung microvascular endothelial cells (HLMVECs) via PI3K/Akt signal transduction and reactive

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.