Direkt zum Inhalt
Merck

EHU055871

Sigma-Aldrich

MISSION® esiRNA

targeting human ETV5

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TACCATCGGCAAATGTCAGAACCTATTGTCCCTGCAGCTCCCCCGCCCCCTCAGGGATTCAAACAAGAATACCATGACCCACTCTATGAACATGGGGTCCCGGGCATGCCAGGGCCCCCAGCACACGGGTTCCAGTCACCAATGGGAATCAAGCAGGAGCCTCGGGATTACTGCGTCGATTCAGAAGTGCCTAACTGCCAGTCATCCTACATGAGAGGGGGTTATTTCTCCAGCAGCCATGAAGGTTTTTCATATGAAAAAGATCCCCGATTATACTTTGACGACACTTGTGTTGTGCCTGAGAGACTGGAAGGCAAAGTCAAACAGGAGCCTACCATGTATCGAGAGGGGCCCCCTTACCAGAGGCGAGGTTCCCTTCAGCTGTGGCAGTTCCTGGTCACCCTTCTTGATGACCCAGCCAATGCCCACTTCATTGCCTGGACAGGT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Félicie Cottard et al.
Oncotarget, 8(42), 72008-72020 (2017-10-27)
Constitutively active androgen receptor (AR) variants have been involved in the expression of mesenchymal markers such as N-cadherin in prostate cancer (PCa). However, the underlying molecular mechanisms remain elusive. It remains unclear, whether N-cadherin gene (CDH2) is a direct transcriptional
Duy Pham et al.
The Journal of allergy and clinical immunology, 134(1), 204-214 (2014-02-04)
The differentiation of TH17 cells, which promote pulmonary inflammation, requires the cooperation of a network of transcription factors. We sought to define the role of Etv5, an Ets-family transcription factor, in TH17 cell development and function. TH17 development was examined
Jong-Min Park et al.
Free radical biology & medicine, 110, 151-161 (2017-06-13)
8-hydroxydeoxyguanosine (8-OHdG) is generated consequent to oxidative stress, but its paradoxical anti-oxidative, anti-inflammatory, and anti-mutagenic effects via Rho-GTPase inhibition were noted in various models of inflammation and cancer. Metastasis occurs through cell detachment, epithelial-mesenchymal transition (EMT), and cell migration; during
Oorvashi Roy Puli et al.
Neoplasia (New York, N.Y.), 20(11), 1121-1134 (2018-09-29)
The ETS family of transcription factors is involved in several normal remodeling events and pathological processes including tumor progression. ETS transcription factors are divided into subfamilies based on the sequence and location of the ETS domain. ETV5 (Ets variant gene

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.