Direkt zum Inhalt
Merck

EHU051131

Sigma-Aldrich

MISSION® esiRNA

targeting human TGFBR1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AAAGTCATCACCTGGCCTTGGTCCTGTGGAACTGGCAGCTGTCATTGCTGGACCAGTGTGCTTCGTCTGCATCTCACTCATGTTGATGGTCTATATCTGCCACAACCGCACTGTCATTCACCATCGAGTGCCAAATGAAGAGGACCCTTCATTAGATCGCCCTTTTATTTCAGAGGGTACTACGTTGAAAGACTTAATTTATGATATGACAACGTCAGGTTCTGGCTCAGGTTTACCATTGCTTGTTCAGAGAACAATTGCGAGAACTATTGTGTTACAAGAAAGCATTGGCAAAGGTCGATTTGGAGAAGTTTGGAGAGGAAAGTGGCGGGGAGAAGAAGTTGCTGTTAAGATATTCTCCTCTAGAGAAGAACGTTCGTGGTTCCGTGAGGCAGAGATTT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Weitang Liao et al.
Frontiers in physiology, 11, 1093-1093 (2020-10-06)
Renal tubulointerstitial fibrosis is usually the final outcome of various end-stage renal diseases. Recent studies have reported that microRNAs (miRNAs) play an important role in renal fibrosis. However, the biological function of microRNAs in renal fibrosis is complicated and remains
Hilène Lin et al.
Scientific reports, 8(1), 10488-10488 (2018-07-12)
Cartilage loss in osteoarthritis (OA) results from altered local production of growth factors and metalloproteases (MMPs). Furin, an enzyme involved in the protein maturation of MMPs, might regulate chondrocyte function. Here, we tested the effect of furin on chondrocyte catabolism
Lincan Duan et al.
PloS one, 13(7), e0200452-e0200452 (2018-07-12)
In the tumor progression, transforming growth factor β1 (TGFβ1) plays a critical role in tumorigenesis as well as metastasis. It is known that high plasma level of TGFβ1 in patients with advanced non-small cell lung cancer (NSCLC) is correlated with
Kaushal Asrani et al.
The Journal of clinical investigation, 127(11), 4001-4017 (2017-09-26)
Despite its central position in oncogenic intracellular signaling networks, the role of mTORC1 in epithelial development has not been studied extensively in vivo. Here, we have used the epidermis as a model system to elucidate the cellular effects and signaling
Si-Rui Ma et al.
Oncotarget, 6(11), 8807-8821 (2015-04-15)
Anterior gradient protein 2 (AGR2) is a novel biomarker with potential oncogenic role. We sought to investigate the diagnostic and prognostic role of AGR2 on head and neck squamous cell carcinoma (HNSCC) with an emphasis on its correlation of cancer

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.