Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU050291

Sigma-Aldrich

MISSION® esiRNA

targeting human MLH1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CAGAGGAAGATGGTCCCAAAGAAGGACTTGCTGAATACATTGTTGAGTTTCTGAAGAAGAAGGCTGAGATGCTTGCAGACTATTTCTCTTTGGAAATTGATGAGGAAGGGAACCTGATTGGATTACCCCTTCTGATTGACAACTATGTGCCCCCTTTGGAGGGACTGCCTATCTTCATTCTTCGACTAGCCACTGAGGTGAATTGGGACGAAGAAAAGGAATGTTTTGAAAGCCTCAGTAAAGAATGCGCTATGTTCTATTCCATCCGGAAGCAGTACATATCTGAGGAGTCGACCCTCTCAGGCCAGCAGAGTGAAGTGCCTGGCTCCATTCCAAACTCCTGGAAGTGGACTGTGGAACACATTGTCTATAAAGCCTTGCGCTCACACATTCTGCCTCCTAAACATTTCACAGAAGATGGAAATATCCTGCAGCTTGCTAACCTGCCTGATC

Ensembl | Human Hinterlegungsnummer

ENSG00000076242

NCBI-Hinterlegungsnummer

NM_000249

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... MLH1(4292) , MLH1(4292)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Lucio Tentori et al.
BMC cancer, 14, 151-151 (2014-03-07)
Chemoresistance of glioblastoma multiforme (GBM) has been attributed to the presence within the tumor of cancer stem cells (GSCs). The standard therapy for GBM consists of surgery followed by radiotherapy and the chemotherapeutic agent temozolomide (TMZ). However, TMZ efficacy is
Jinfeng Cui et al.
Food and chemical toxicology : an international journal published for the British Industrial Biological Research Association, 115, 205-211 (2018-03-17)
Sterigmatocystin (ST), being a precursor of aflatoxin, is categorized as Group 2B carcinogen. Our previous studies found that both mismatch repair (MMR) pathways and p53 signaling pathway were involved in ST-induced G2 cell cycle arrest in human esophageal squamous epithelial
Jun-Yu Lu et al.
Oncotarget, 8(24), 38767-38779 (2017-04-14)
Epidemiological data demonstrated that hormone replace treatment has protective effect against colorectal cancer (CRC). Our previous studies showed that this effect may be associated with DNA mismatch repair. This study aims to investigate the mechanism of estrogen induction of MLH1
Min Peng et al.
The EMBO journal, 33(15), 1698-1712 (2014-06-27)
Several proteins in the BRCA-Fanconi anemia (FA) pathway, such as FANCJ, BRCA1, and FANCD2, interact with mismatch repair (MMR) pathway factors, but the significance of this link remains unknown. Unlike the BRCA-FA pathway, the MMR pathway is not essential for
Daniel J McGrail et al.
Cancer cell, 37(3), 371-386 (2020-02-29)
Deficient DNA mismatch repair (dMMR) induces a hypermutator phenotype that can lead to tumorigenesis; however, the functional impact of the high mutation burden resulting from this phenotype remains poorly explored. Here, we demonstrate that dMMR-induced destabilizing mutations lead to proteome

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.