Direkt zum Inhalt
Merck

EHU047441

Sigma-Aldrich

MISSION® esiRNA

targeting human NQO1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GCCGCAGACCTTGTGATATTCCAGTTCCCCCTGCAGTGGTTTGGAGTCCCTGCCATTCTGAAAGGCTGGTTTGAGCGAGTGTTCATAGGAGAGTTTGCTTACACTTACGCTGCCATGTATGACAAAGGACCCTTCCGGAGTAAGAAGGCAGTGCTTTCCATCACCACTGGTGGCAGTGGCTCCATGTACTCTCTGCAAGGGATCCACGGGGACATGAATGTCATTCTCTGGCCAATTCAGAGTGGCATTCTGCATTTCTGTGGCTTCCAAGTCTTAGAACCTCAACTGACATATAGCATTGGGCACACTCCAGCAGACGCCCGAATTCAAATCCTGGAAGGATGGAAGAAACGCCTGGAGAATATTTGGGATGAGACACCACTGTATTTTGCTCCAAGCAGCC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Brian Madajewski et al.
Molecular cancer research : MCR, 14(1), 14-25 (2015-11-11)
The fundamental role that NAD(P)H/quinone oxidoreductase 1 (NQO1) plays, in normal cells, as a cytoprotective enzyme guarding against stress induced by reactive oxygen species (ROS) is well documented. However, what is not known is whether the observed overexpression of NQO1
Xiang-Zhai Zhao et al.
OncoTargets and therapy, 11, 3609-3617 (2018-06-29)
Spindlactone A (SPL-A) is a novel small molecule inhibitor of TACC3 that selectively inhibits the nucleation of centrosome microtubules and induces mitotic arrest in ovarian cancer cells. SPL-A is derived from dicoumarol which inhibits the activity of NAD(P)H dehydrogenase quinone
Siriwoot Butsri et al.
Oncology letters, 13(6), 4540-4548 (2017-06-11)
We previously reported that upregulation of NAD(P)H:quinone oxidoreductase 1 (NQO1) in cholangiocarcinoma (CCA; a fatal bile duct cancer) was associated with poor prognosis. It was also demonstrated that the suppression of NQO1 was able to enhance the chemosensitivity of CCA
Masahiro Sekiguchi et al.
NPJ precision oncology, 4, 20-20 (2020-07-14)
Although hepatoblastoma is the most common pediatric liver cancer, its genetic heterogeneity and therapeutic targets are not well elucidated. Therefore, we conducted a multiomics analysis, including mutatome, DNA methylome, and transcriptome analyses, of 59 hepatoblastoma samples. Based on DNA methylation
Surendra Reddy Punganuru et al.
Cancers, 10(12) (2018-11-30)
Human NAD(P)H quinone oxidoreductase-1 (hNQO1) is an important cancer-related biomarker, which shows significant overexpression in malignant cells. Developing an effective method for detecting NQO1 activity with high sensitivity and selectivity in tumors holds a great potential for cancer diagnosis, treatment

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.