Direkt zum Inhalt
Merck

EHU039391

Sigma-Aldrich

MISSION® esiRNA

targeting human PIK3CA

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ACCTTGTTCCAATCCCAGGTGGAATGAATGGCTGAATTATGATATATACATTCCTGATCTTCCTCGTGCTGCTCGACTTTGCCTTTCCATTTGCTCTGTTAAAGGCCGAAAGGGTGCTAAAGAGGAACACTGTCCATTGGCATGGGGAAATATAAACTTGTTTGATTACACAGACACTCTAGTATCTGGAAAAATGGCTTTGAATCTTTGGCCAGTACCTCATGGATTAGAAGATTTGCTGAACCCTATTGGTGTTACTGGATCAAATCCAAATAAAGAAACTCCATGCTTAGAGTTGGAGTTTGACTGGTTCAGCAGTGTGGTAAAGTTCCCAGATATGTCAGTGATTGAAGAGCATGCCAATTGGTCTGTATCCCGAGAAGCAGGATTTAGCTATTCCCACGCAGG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Xiuling Liang et al.
Yonsei medical journal, 60(2), 182-190 (2019-01-23)
This study aimed to investigate the effects of PIK3CA on the sensitivity of acute B lymphocytic leukemia cells (Nalm-6 cells) to chemotherapy drugs. Children's normal B lymphocytes and Nalm-6 cells were cultured. Nalm-6 cells were transfected with PIK3CA siRNA (siPIK3CA
Shuke Ge et al.
Oncology research, 25(8), 1363-1371 (2017-03-02)
miR-152, as a tumor suppressor, has been reported to be downregulated in a number of cancer cell lines and tumor tissues, including breast cancer. This study aimed to investigate the role of miR-152 in human breast cancer and its underlying
Zhao Wang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 43(6), 2505-2515 (2017-11-14)
Numerous studies have demonstrated that aberrant microRNA (miRNA) expression is involved in human disease including cancer. To date, the potential miRNAs regulating lung cancer growth and progression are not fully identified yet. In this study, the expression of miR-142-5p was
Jun Xu et al.
Molecular medicine reports, 12(3), 4708-4712 (2015-06-24)
The expression of osteopontin (OPN) and vascular endothelial growth factor (VEGF) are associated with the severity of cartilage destruction in osteoarthritis. However, the biological connection between OPN and VEGF in osteoarthritis remains to be elucidated. The present study was performed
Zhenyou Zou et al.
Journal of drug targeting, 22(9), 839-848 (2014-07-16)
Multi-drug resistance (MDR) cancer is an intractable problem. Over-expression of drug efflux transporters such as ABCB1, ABCC1 and ABCG2 contributes to it, by which they pump drugs out of cells, and result in the decrease in the efficacy of chemotherapy.

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.