Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU034291

Sigma-Aldrich

MISSION® esiRNA

targeting human FOS

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AGAATCCGAAGGGAAAGGAATAAGATGGCTGCAGCCAAATGCCGCAACCGGAGGAGGGAGCTGACTGATACACTCCAAGCGGAGACAGACCAACTAGAAGATGAGAAGTCTGCTTTGCAGACCGAGATTGCCAACCTGCTGAAGGAGAAGGAAAAACTAGAGTTCATCCTGGCAGCTCACCGACCTGCCTGCAAGATCCCTGATGACCTGGGCTTCCCAGAAGAGATGTCTGTGGCTTCCCTTGATCTGACTGGGGGCCTGCCAGAGGTTGCCACCCCGGAGTCTGAGGAGGCCTTCACCCTGCCTCTCCTCAATGACCCTGAGCCCAAGCCCTCAGTGGAACCTGTCAAGAGCATCAGCAGCATGGAGCTGAAGACCGAGCCCTTTGATGACTTCCTGTTCCCAGCATCAT

Ensembl | Human Hinterlegungsnummer

ENSG00000170345

NCBI-Hinterlegungsnummer

NM_005252

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... FOS(2353) , FOS(2353)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Peipei Jin et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 83, 1212-1219 (2016-10-25)
Interleukin-1 receptor-associated kinase M (IRAK-M) is a well-known negative regulator for Toll-like receptor signaling, which can regulate immune homeostasis and tolerance in a number of pathological settings. However, the mechanism for IRAK-M regulation at transcriptional level remains largely unknown. In
Yahui Zhao et al.
The Journal of biological chemistry, 291(13), 6831-6842 (2016-02-10)
ID1 (inhibitor of differentiation/DNA binding 1) acts an important role in metastasis, tumorigenesis, and maintenance of cell viability. It has been shown that the up-regulation of ID1 is correlated with poor prognosis and the resistance to chemotherapy of human cancers.
Lianjie Hou et al.
Cells, 8(6) (2019-06-20)
Skeletal muscle plays an essential role in maintaining body energy homeostasis and body flexibility. Loss of muscle mass leads to slower wound healing and recovery from illness, physical disability, poor quality of life, and higher health care costs. So, it
Rui Bao et al.
American journal of translational research, 8(5), 2284-2292 (2016-06-28)
Forkhead/winged helix transcription factor p3 (Foxp3) increases in CD4(+)CD25(+)Treg cells during sepsis; however, related mechanisms are unclear. Our study aimed to explore the possible molecular mechanisms of high expression of Foxp3 in Treg cells during sepsis. Sepsis was induced by
Li Lin et al.
Journal of cellular physiology, 234(10), 18928-18941 (2019-04-21)
Pre-eclampsia (PE) is a serious hypertensive disorder of pregnancy that remains a leading cause of perinatal and maternal morbidity and mortality worldwide. Placental ischemia/hypoxia and the secretion of soluble fms-like tyrosine kinase 1 (sFlt1) into maternal circulation are involved in
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.