Direkt zum Inhalt
Merck

EHU032751

Sigma-Aldrich

MISSION® esiRNA

targeting human THBS1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ATGGAATTGGTGATGCCTGTGATGATGACGATGACAATGATAAAATTCCAGATGACAGGGACAACTGTCCATTCCATTACAACCCAGCTCAGTATGACTATGACAGAGATGATGTGGGAGACCGCTGTGACAACTGTCCCTACAACCACAACCCAGATCAGGCAGACACAGACAACAATGGGGAAGGAGACGCCTGTGCTGCAGACATTGATGGAGACGGTATCCTCAATGAACGGGACAACTGCCAGTACGTCTACAATGTGGACCAGAGAGACACTGATATGGATGGGGTTGGAGATCAGTGTGACAATTGCCCCTTGGAACACAATCCGGATCAGCTGGACTCTGACTCAGACCGCATTGGAGATACCTGTGACAACAATCAGGATATTGATGAAGATGGCCACCAGAAC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Hui Hu et al.
Clinical science (London, England : 1979), 133(14), 1629-1644 (2019-07-19)
Background: Our previous studies observed that administration of exosomes from endothelial progenitor cells (EPC) facilitated vascular repair in the rat model of balloon injury. However, the molecular events underlying this process remain elusive. Here, we aim to interrogate the key
Jeneen Panezai et al.
Immunology, 152(2), 308-327 (2017-06-06)
Cell adhesion is generally considered to depend on positive regulation through ligation of integrins and cytokine receptors. However, here we show that T-cell adhesion, and notably also T-cell receptor (TCR) -induced activation, are subject to constant suppression through shedding of
Gun-Hoo Park et al.
Nature neuroscience, 23(11), 1352-1364 (2020-10-25)
The mechanisms by which prenatal immune activation increase the risk for neuropsychiatric disorders are unclear. Here, we generated developmental cortical interneurons (cINs)-which are known to be affected in schizophrenia (SCZ) when matured-from induced pluripotent stem cells (iPSCs) derived from healthy
Albin Jeanne et al.
Oncotarget, 6(20), 17981-18000 (2015-06-06)
The multi-modular glycoprotein thrombospondin-1 (TSP-1) is considered as a key actor within the tumor microenvironment. Besides, TSP-1 binding to CD47 is widely reported to regulate cardiovascular function as it promotes vasoconstriction and angiogenesis limitation. Therefore, many studies focused on targeting

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.