Direkt zum Inhalt
Merck

EHU030961

Sigma-Aldrich

MISSION® esiRNA

targeting human ERBB3

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGGAACTGTGCACAAAGGAGTGTGGATCCCTGAGGGTGAATCAATCAAGATTCCAGTCTGCATTAAAGTCATTGAGGACAAGAGTGGACGGCAGAGTTTTCAAGCTGTGACAGATCATATGCTGGCCATTGGCAGCCTGGACCATGCCCACATTGTAAGGCTGCTGGGACTATGCCCAGGGTCATCTCTGCAGCTTGTCACTCAATATTTGCCTCTGGGTTCTCTGCTGGATCATGTGAGACAACACCGGGGGGCACTGGGGCCACAGCTGCTGCTCAACTGGGGAGTACAAATTGCCAAGGGAATGTACTACCTTGAGGAACATGGTATGGTGCATAGAAACCTGGCTGCCCGAAACGTGCTACTCAAGTCACCCAGTCAGGTTCAGGTGGCAGATTTTGGTGTGGCTGACCT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Sarah Croessmann et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 25(1), 277-289 (2018-10-14)
We examined the role of ERBB2-activating mutations in endocrine therapy resistance in estrogen receptor positive (ER+) breast cancer. ERBB2 mutation frequency was determined from large genomic databases. Isogenic knock-in ERBB2 mutations in ER+ MCF7 cells and xenografts were used to
Majid Momeny et al.
Cellular oncology (Dordrecht), 42(4), 491-504 (2019-04-27)
Pancreatic ductal adenocarcinoma (PDAC), the most common malignancy of the pancreas, is the fourth most common cause of cancer-related death in the USA. Local progression, early tumor dissemination and low efficacy of current treatments are the major reasons for its
Human Papillomavirus Regulates HER3 Expression in Head and Neck Cancer: Implications for Targeted HER3 Therapy in HPV
Toni M Brand et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 23(12), 3072-3083 (2016-12-18)
Aili Wang et al.
Aging, 12(6), 4866-4878 (2020-03-15)
Development of specific serum biomarkers is essential to improve diagnosis and prognosis of non-small cell lung cancer (NSCLC). Here, we show that serum and tissue levels of miR-519d are significantly decreased in NSCLC patients. The low expression of miR-519d is
Spencer S Watson et al.
Cell systems, 6(3), 329-342 (2018-03-20)
Extrinsic signals are implicated in breast cancer resistance to HER2-targeted tyrosine kinase inhibitors (TKIs). To examine how microenvironmental signals influence resistance, we monitored TKI-treated breast cancer cell lines grown on microenvironment microarrays composed of printed extracellular matrix proteins supplemented with

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.