Direkt zum Inhalt
Merck

EHU026341

Sigma-Aldrich

MISSION® esiRNA

targeting human GLI1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GCCCAATCACAAGTCAGGTTCCTATCCCACCCCTTCACCATGCCATGAAAATTTTGTAGTGGGGGCAAATAGGGCTTCACATAGGGCAGCAGCACCACCTCGACTTCTGCCCCCATTGCCCACTTGCTATGGGCCTCTCAAAGTGGGAGGCACAAACCCCAGCTGTGGTCATCCTGAGGTGGGCAGGCTAGGAGGGGGTCCTGCCTTGTACCCTCCTCCCGAAGGACAGGTATGTAACCCCCTGGACTCTCTTGATCTTGACAACACTCAGCTGGACTTTGTGGCTATTCTGGATGAGCCCCAGGGGCTGAGTCCTCCTCCTTCCCATGATCAGCGGGGCAGCTCTGGACATACCCCACCTCCCTCTGGGCCCCCCAACATGGCTGTGGGCAACATGAGTGTCTTACTGAGATCCCTACCTGGGGAAACAGAATTCCTCAACTCTAGTGCCTAAAGAGTAGGGAATCTCATCCATCACAGATCGCAT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Yang Chong et al.
Journal of experimental & clinical cancer research : CR, 35(1), 175-175 (2016-11-12)
Gastric cancer (GC) is characterized by the excessive deposition of extracellular matrix, which is thought to contribute to this tumor's malignant behavior. Epithelial-mesenchymal transition (EMT) is regarded as a crucial contributing factor to cancer progression. Galectin-1 (Gal-1), a β-galactoside-binding protein
Xinyi Cai et al.
OncoTargets and therapy, 8, 877-883 (2015-05-07)
The Hedgehog (Hh) signaling pathway not only plays important roles in embryogenesis and adult tissue homeostasis, but also in tumorigenesis. Aberrant Hh pathway activation has been reported in a variety of malignant tumors including colon carcinoma. Here, we sought to
Hyungsin Kim et al.
Cancers, 11(9) (2019-09-08)
Despite the presence of aggressive treatment strategies, glioblastoma remains intractable, warranting a novel therapeutic modality. An oral antipsychotic agent, penflurido (PFD), used for schizophrenia treatment, has shown an antitumor effect on various types of cancer cells. As glioma sphere-forming cells
Yumei Diao et al.
Molecular oncology, 12(10), 1718-1734 (2018-08-12)
Hedgehog (HH) signaling is involved in many physiological processes, and pathway deregulation can result in a wide range of malignancies. Glioma-associated oncogene 1 (GLI1) is a transcription factor and a terminal effector of the HH cascade. Despite its crucial role
Guodong Zhang et al.
Experimental and therapeutic medicine, 19(4), 2913-2922 (2020-04-08)
The efficacy of ginsenoside Rh2 (Rh2) in cancer therapy has been reported; however, its function in lung cancer remains unknown. To analyze the role of Rh2 in the inhibition of lung cancer cell proliferation in the present study, protein expression

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.