Direkt zum Inhalt
Merck

EHU017331

Sigma-Aldrich

MISSION® esiRNA

targeting human TIMP2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AAGCGGTCAGTGAGAAGGAAGTGGACTCTGGAAACGACATTTATGGCAACCCTATCAAGAGGATCCAGTATGAGATCAAGCAGATAAAGATGTTCAAAGGGCCTGAGAAGGATATAGAGTTTATCTACACGGCCCCCTCCTCGGCAGTGTGTGGGGTCTCGCTGGACGTTGGAGGAAAGAAGGAATATCTCATTGCAGGAAAGGCCGAGGGGGACGGCAAGATGCACATCACCCTCTGTGACTTCATCGTGCCCTGGGACACCCTGAGCACCACCCAGAAGAAGAGCCTGAACCACAGGTACCAGATGGGCTGCGAGTGCAAGATCACGCGCTGCCCCATGATCCCGTGCTACATCTCCTCCCCGGACGAGTGCCTCTGGATGGACTGGGTCACAGAGAAGAACATCAACGGGCACCAGGCCAAGTTCTTCGCCTGCATCAAGAGAAGTGACGGCTCCTGTGCGTGGTACCGCGGCGCGGCGCCCCCCAAGCAGGAGTTTCTCGAC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA ist durch Endoribonuklease hergestellte siRNA. Dabei handelt es sich um eine heterogene Mischung von siRNA, die alle dieselbe mRNA-Zielsequenz haben. Diese mehrfachen Auslöser bewirken eine hochspezifische und wirksame Genstummschaltung.

Weitere Einzelheiten sowie eine Darstellung aller erhältlichen esiRNA-Produkte finden Sie unter SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Ji-Xiang Cao
Oncology reports, 41(6), 3367-3376 (2019-04-20)
Aberrantly expressed miRNAs play a crucial role in the progression of lung adenocarcinoma. However, to date, the role of miR‑888 in lung adenocarcinoma progression is unclear. In the present study, the biological function of miR‑888 and its underlying mechanism in
Guijun Zhang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 118, 109309-109309 (2019-09-24)
To explore the roles of long noncoding RNA (lncRNA) FOXF1 Adjacent Non-Coding Developmental Regulatory RNA (FENDRR) in human non-small cell lung cancer (NSCLC). The levels of FENDRR in NSCLC cells and tissues were analyzed using qRT-PCR assay. The growth and
Shanlan Yin et al.
Experimental and therapeutic medicine, 17(4), 2837-2846 (2019-03-25)
Human papillomaviruses (HPVs) have important roles in the development and progression of cervical cancer, but the underlying mechanisms are yet to be fully elucidated. MicroRNA-130a (miR-130a) has previously been reported to promote cervical cancer growth. However, the underlying molecular mechanisms
Hao Guan et al.
PloS one, 12(12), e0189490-e0189490 (2017-12-09)
MicroRNAs (miRNAs) are important regulators of pathobiological processes in various cancer. In the present study, we demonstrated that miR-93 expression was significantly up-regulated in gastric cancer tissues compared with that in matched normal mucosal tissues. High expression of miR-93 was
Yuan Cheng et al.
Molecular medicine reports, 16(4), 5464-5470 (2017-08-30)
Human papillomavirus (HPV) infection alone is not sufficient for development of cervical cancer and further risk factors are involved, however, the underlying mechanism remains to be elucidated. The authors previously used a microarray assay to reveal microR‑20b (miR‑20b) as a key

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.