Direkt zum Inhalt
Merck

EHU009041

Sigma-Aldrich

MISSION® esiRNA

targeting human FIGN

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CGGCTCTGACAAACAGTTCAGCAAGTTCTCTCAAAAGGAAAGCTTTCTACATGGCAGGGCAAGGAGATATGGACTCCAGTTATGGAAATTACAGCTATGGCCAACAGAGATCTACACAGAGTCCTATGTACAGAATGCCCGACAACAGCATTTCAAACACAAATCGGGGGAATGGCTTTGACAGAAGTGCTGAAACATCATCCTTAGCATTTAAGCCAACGAAGCAGCTAATGTCCTCTGAACAGCAAAGGAAATTCAGCAGCCAGTCCAGTAGGGCTCTGACCCCTCCTTCCTACAGTACTGCTAAAAATTCATTGGGATCAAGATCCAGTGAATCCTTTGGGAAGTACACATCGCCAGTAATGAGTGAGCATGGGGACGAGCACAGGCAGCTCCTCTCTCACCCAATGCAAGGCCCTGGACTCCGTGCAGCTACCTCATCCAACCACTCTGTGGACGAGCAACTGAAGAATACTGACACGCACCTCATCGACCTGGTAACCAATGAGATTATCACCCAAGGACCTCCAG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA ist durch Endoribonuklease hergestellte siRNA. Dabei handelt es sich um eine heterogene Mischung von siRNA, die alle dieselbe mRNA-Zielsequenz haben. Diese mehrfachen Auslöser bewirken eine hochspezifische und wirksame Genstummschaltung.

Weitere Einzelheiten sowie eine Darstellung aller erhältlichen esiRNA-Produkte finden Sie unter SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Hye-Lim Lee et al.
International journal of molecular sciences, 19(10) (2018-10-17)
Distal-less homeobox 5 (Dlx5) is a negative regulator of adipogenesis. Dlx5 expression is decreased by adipogenic stimuli, but the mechanisms of Dlx5 downregulation by adipogenic stimuli have not yet been determined. Here, we tested the impact of cAMP/PKA (protein kinase
Xiaolong Yuan et al.
Genes, 9(6) (2018-06-15)
Previous studies suggest that signal transducer and activator of transcription 3 (STAT3) and CCAAT/enhancer binding protein beta (C/EBPβ) play an essential role in ovarian granulosa cells (GCs) for mammalian follicular development. Several C/EBPβ putative binding sites were previously predicted on
Dusan Hrckulak et al.
Genes, 9(9) (2018-09-12)
T-cell factor 4 (TCF4), together with β-catenin coactivator, functions as the major transcriptional mediator of the canonical wingless/integrated (Wnt) signaling pathway in the intestinal epithelium. The pathway activity is essential for both intestinal homeostasis and tumorigenesis. To date, several mouse
Jian-Ming Lü et al.
International journal of molecular sciences, 20(2) (2019-01-16)
We have previously shown that ritonavir (RTV), a highly active anti-retroviral therapy (HAART) drug, can cause endothelial dysfunction through oxidative stress. Several antioxidants including ginsenoside Rb1, a compound with antioxidant effect, can effectively block this side effect of RTV in
Venkata Viswanadh Edara et al.
Biomedicines, 8(11) (2020-11-12)
Reactive astrogliosis is prominent in most neurodegenerative disorders and is often associated with neuroinflammation. The molecular mechanisms regulating astrocyte-linked neuropathogenesis during injury, aging and human immunodeficiency virus (HIV)-associated neurocognitive disorders (HAND) are not fully understood. In this study, we investigated

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.