Direkt zum Inhalt
Merck

EHU003851

Sigma-Aldrich

MISSION® esiRNA

targeting human SAMHD1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ACGCATGAACAAGGCTCAGTTATGATGTTTGAGCACCTTATTAATTCTAATGGAATTAAGCCTGTCATGGAACAATATGGTCTCATCCCTGAAGAAGATATTTGCTTTATAAAGGAACAAATTGTAGGACCACTTGAATCACCTGTCGAAGATTCATTGTGGCCATATAAAGGGCGTCCTGAAAACAAAAGCTTCCTTTATGAGATAGTATCTAATAAAAGAAATGGCATTGATGTGGACAAATGGGATTATTTTGCCAGGGACTGCCATCATCTTGGAATCCAAAATAATTTTGATTACAAGCGCTTTATTAAGTTTGCCCGTGTCTGTGAAGTAGACAATGAGTTGCGTATTTGTGCTAGAGATAAGGAAGTTGGAAATCTGTATGACATGTTCCACACTCGCAACTCTTTACACCGTAGAGCTTATCAACACAAAGTTGGCAACATTATTGATACAATGATTACAGATGCTTTCCTCAAAGCAGATGACTACATAGAGATTACAGGTGCTGGAGGAAAAAAGTATCGCATTTCTACAGCAATTGACGACATGGA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA ist durch Endoribonuklease hergestellte siRNA. Dabei handelt es sich um eine heterogene Mischung von siRNA, die alle dieselbe mRNA-Zielsequenz haben. Diese mehrfachen Auslöser bewirken eine hochspezifische und wirksame Genstummschaltung.

Weitere Einzelheiten sowie eine Darstellung aller erhältlichen esiRNA-Produkte finden Sie unter SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Weihui Fu et al.
Scientific reports, 6, 38162-38162 (2016-12-07)
SAMHD1 restricts human immunodeficiency virus type 1 (HIV-1) replication in myeloid cells and CD4+ T cells, while Vpx can mediate SAMHD1 degradation to promote HIV-1 replication. Although the restriction mechanisms of SAMHD1 have been well-described, SAMHD1 expression and Vpx-mediated SAMHD1
Thomas Oellerich et al.
Nature communications, 10(1), 3475-3475 (2019-08-04)
Hypomethylating agents decitabine and azacytidine are regarded as interchangeable in the treatment of acute myeloid leukemia (AML). However, their mechanisms of action remain incompletely understood, and predictive biomarkers for HMA efficacy are lacking. Here, we show that the bioactive metabolite
Jiaming Su et al.
Nature microbiology, 4(12), 2552-2564 (2019-10-30)
Innate immunity is the first line of host defence against pathogens. Suppression of innate immune responses is essential for the survival of all viruses. However, the interplay between innate immunity and HIV/SIV is only poorly characterized. We have discovered Vpx
Vera Rocha-Perugini et al.
Nature microbiology, 2(11), 1513-1522 (2017-09-06)
In this study, we report that the tetraspanin CD81 enhances human immunodeficiency virus (HIV)-1 reverse transcription in HIV-1-infected cells. This is enabled by the direct interaction of CD81 with the deoxynucleoside triphosphate phosphohydrolase SAMHD1. This interaction prevents endosomal accumulation and
Diana Ayinde et al.
Journal of virology, 89(14), 6994-7006 (2015-05-01)
Monocyte-derived dendritic cells (MDDC) stimulate CD8 cytotoxic T lymphocytes (CTL) by presenting endogenous and exogenous viral peptides via major histocompatibility complex class I (MHC-I) molecules. MDDC are poorly susceptible to HIV-1, in part due to the presence of SAMHD1, a

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.