Direkt zum Inhalt
Merck
Alle Fotos(1)

Wichtige Dokumente

Gesamtdokumentation anzeigen

EHU002651

Sigma-Aldrich

MISSION® esiRNA

targeting human MAP1LC3B

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

100

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TCCAAGTGAGCACATTCAGCTTTGGAAACTATATTATTTAATGTAGGCTAGCTTGTTTTCAAATTTTAAAAGTTTAAAAATAAAATACTTTGCATTCTAAGTTGCCAATAAAATAGACCTTCAAGTTATTTTAATGCTCTTTTCTCACTAATAGGAACTTGTAATTCCAGCAGTAATTTAAAGGCTTTCAGAGAGACCCTGAGTCTTCTCTTCAGGTTCACAAAACCCGCCGCCTTTTTGGGTAGAAGTTTTCTACTCAGCTAGAGAGATCTCCCTAAGAGGATCTTTAGGCCTGAGTTGTGAAGCGCAACCCCCGCAAAACGCATTTGCCATCACAGTTGGCACAAACGCAGGGTAAACGGGCTGTGTGAGAAAACGGCCCTGACTGTAAACTGCTGAAGGTCCCTGACTCCTAAGAGAACCACACCCAAAGTCCTCACT

Ensembl | Human Hinterlegungsnummer

ENSG00000140941

NCBI-Hinterlegungsnummer

NM_022818

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... MAP1LC3B(81631) , MAP1LC3B(81631)

Allgemeine Beschreibung

MISSION® esiRNA ist durch Endoribonuklease hergestellte siRNA. Dabei handelt es sich um eine heterogene Mischung von siRNA, die alle dieselbe mRNA-Zielsequenz haben. Diese mehrfachen Auslöser bewirken eine hochspezifische und wirksame Genstummschaltung.

Weitere Einzelheiten sowie eine Darstellung aller erhältlichen esiRNA-Produkte finden Sie unter SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Tamotsu Tsukahara et al.
BioMed research international, 2013, 204973-204973 (2013-11-30)
Our previous study demonstrated that PTB-associated splicing factor (PSF) is an important regulator of cell death and plays critical roles in the survival and growth of colon cancer cells. However, the molecular mechanism that activates these downstream signaling events remains
Alok Ranjan et al.
Scientific reports, 6, 26165-26165 (2016-05-18)
Pancreatic tumors exhibit enhanced autophagy as compared to any other cancer, making it resistant to chemotherapy. We evaluated the effect of penfluridol against pancreatic cancer. Penfluridol treatment induced apoptosis and inhibited the growth of Panc-1, BxPC-3 and AsPC-1, pancreatic cancer
Sheeja Aravindan et al.
Journal of biomedical science, 22, 28-28 (2015-04-22)
Identifying the drug-deliverables that target autophagy is crucial to finding a cure for pancreatic cancer (PC), as activated autophagy is associated with poor patient outcomes. Our recent studies recognized the anti-PC potential of an antioxidant-rich collection of seaweed polyphenols and
S Kumar et al.
Cell death & disease, 4, e889-e889 (2013-11-02)
Angiogenesis has a key role in the tumor progression and metastasis; targeting endothelial cell proliferation has emerged as a promising therapeutic strategy for the prevention of cancer. Previous studies have revealed a complex association between the process of angiogenesis and
Saroj Nepal et al.
Biomolecules & therapeutics, 22(5), 384-389 (2014-11-22)
Adiponectin, an adipokine predominantly secreted from adipose tissue, exhibits diverse biological responses, including metabolism of glucose and lipid, and apoptosis in cancer cells. Recently, adiponectin has been shown to modulate autophagy as well. While emerging evidence has demonstrated that autophagy
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.