NCSTUD002

MISSION^® Synthetic microRNA Inhibitor

cel-miR-243-3p, Negative Control 2, Sequence from Caenorhabditis elegans with no homology to human and mouse gene sequences

• Synonyme(s) : Synthetic Tough Decoy, sTuD
• Code UNSPSC : 41105324
• Nomenclature NACRES : NA.51

Propriétés

• Gamme de produits: MISSION^®
• Forme: solid
• Séquence mature: CGGUACGAUCGCGGCGGGAUAUC
• Numéro d'accès Sanger mature/mineur: MIMAT0000299
• Numéro d'accès Sanger microARN: MI0000319
• Température de stockage: −20°C

Description

Description générale

Individual synthetic microRNA inhibitors were designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo.† This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation.

The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.

• Long lasting inhibition at very low dosage
• Excellent resistance to cellular nucleases
• Custom synthesis available for a variety of species

Autres remarques

Based on miRBase V19

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Informations sur la sécurité

• Pictogrammes: GHS08
• Mention d'avertissement: Warning
• Mentions de danger: H373
• Conseils de prudence: P260 - P314 - P501
• Classification des risques: STOT RE 2 Inhalation
• Organes cibles: Respiratory Tract
• Code de la classe de stockage: 11 - Combustible Solids
• Classe de danger pour l'eau (WGK): WGK 3
• Point d'éclair (°F): Not applicable
• Point d'éclair (°C): Not applicable