Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EMU216481

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Vcan

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GTCATAGCAAGCCCAGAGCAGCTGTTTGCCGCCTATGAGGATGGATTTGAGCAGTGTGATGCAGGATGGCTGTCTGATCAAACTGTCAGATATCCCATACGGGCTCCCCGAGAGGGCTGTTACGGAGACATGATGGGGAAGGAAGGGGTTCGGACCTATGGATTCCGCTCTCCCCAGGAAACCTATGATGTGTATTGTTATGTGGATCATCTGGATGGCGATGTGTTCCACATCACTGCTCCCAGTAAGTTCACCTTCGAGGAGGCCGAAGCAGAGTGTACAAGCAGGGATGCGAGGCTGGCGACTGTTGGAGAACTTCAGGCAGCTTGGAGAAATGGCTTTGACCAATGCGATTACGGCTGGCTGTCGGATGCCAGCGTGCGGCACCCTGTGACTGTGGCCAGGGCCCAGTGTGGAGGAGGTCTACTTGGGGTGAGAACCCTGTATCGTTTTGAGAACCAGACATGCTTCCCTCTCCCTGATAGCAGATTTGATGCCTACTGCTTTAAA

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Désolés, nous n'avons pas de COA pour ce produit disponible en ligne pour le moment.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Naoko Arichi et al.
Oncoscience, 2(2), 193-204 (2015-04-11)
In the current study, we investigated a combination of docetaxel and thalidomide (DT therapy) in castration-resistant prostate cancer (CRPC) patients. We identified marker genes that predict the effect of DT therapy. Using an androgen-insensitive PC3 cell line, we established a
Pamela A Havre et al.
BMC cancer, 13, 517-517 (2013-11-05)
CD26/dipeptidyl peptidase IV (DPPIV) is a multifunctional membrane protein with a key role in T-cell biology and also serves as a marker of aggressive cancers, including T-cell malignancies. Versican expression was measured by real-time RT-PCR and Western blots. Gene silencing
Lu-lu Xu et al.
Respiratory physiology & neurobiology, 215, 58-63 (2015-05-23)
COPD lung is characterized by loss of alveolar elastic fibers and an increase in the chondroitin sulfate (CS) matrix proteoglycan versican V1 (V1). V1 is a known inhibitor of elastic fiber deposition and this study investigates the effects of knockdown
Zi Wang et al.
Oncology reports, 33(6), 2981-2991 (2015-04-16)
The systematic application of antiangiogenic therapy remains an issue of concern, mainly due to the hypoxic and inflammatory changes in the tumor microenvironment elicited by antiangiogenic therapy. Versican, a 'bridge' connecting inflammation with tumor progression as well as playing a
Jon M Carthy et al.
Cardiovascular pathology : the official journal of the Society for Cardiovascular Pathology, 24(6), 368-374 (2015-09-24)
Versican is a versatile and highly interactive chondroitin sulfate proteoglycan that is found in the extracellular matrix (ECM) of many tissues and is a major component of developing and developed lesions in atherosclerotic vascular disease. In this paper, we present

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique