Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EMU158861

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cblb

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TCCCAAGCTTCAGTTGAAAAACAGCCCACCGTATATACTTGATATTTTACCTGATACGTATCAGCACTTGAGACTTATATTGAGTAAATATGATGACAACCAGAAGCTGGCTCAACTGAGCGAGAATGAGTACTTTAAAATCTACATCGATAGTCTCATGAAGAAGTCGAAGCGAGCGATCCGGCTCTTTAAAGAAGGCAAGGAAAGGATGTACGAAGAGCAGTCGCAGGACAGACGGAATCTCACAAAGCTGTCCCTTATCTTCAGTCACATGCTGGCAGAAATCAAGGCGATCTTTCCCAATGGCCAGTTCCAGGGAGATAACTTCCGGATCACCAAAGCAGATGCTGCTGAGTTCTGGAGGAAGTTTTTTGGAGACAAAACTATTGTACCATGGAAAGTCTTCAGACAGTGCCTGCATGAGGTCCATCAGATCAGCTCTGGCCTGGAAGCAATGGCTCTGAAGTCAACCATTGATTTAACTTGCAATGATTACATCTCAGTGTTTGAATTTG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Wei-Xia Yang et al.
FEBS letters, 589(15), 1975-1980 (2015-06-27)
Orosomucoid 1-Like Protein 3 (ORMDL3) is an asthma candidate gene and Casitas B lineage lymphoma b (Cbl-b), an E3 ubiquitin ligase, is a critical factor in maintaining airway immune tolerance. However, the association of Cbl-b with ORMDL3 for asthma is
Noah Joseph et al.
FEBS letters, 588(21), 3808-3815 (2014-09-15)
The Nck adapter protein is involved in key cellular functions, such as actin polymerization and reorganization, serving as a molecular bridge between the surface complex essential for foreign antigen recognition, the T-cell antigen receptor (TCR), and the actin machinery. However
Yubo Cao et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(7), 5607-5615 (2015-02-24)
Mammalian target of rapamycin (mTOR) has emerged as a new potential therapeutic target for gastric cancer. However, a phase III clinical trial found that monotherapy with the mTOR inhibitor everolimus did not significantly improve the overall survival of patients with

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique