Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EMU088561

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Jak2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATGGCCTGCCTTACAATGACAGAAATGGAGGCAACCTCCACATCTCCTGTACATCAGAATGGTGATATTCCTGGAAGTGCTAATTCTGTGAAGCAGATAGAGCCAGTCCTTCAAGTGTATCTGTACCATTCTCTTGGGCAAGCTGAAGGAGAGTATCTGAAGTTTCCAAGTGGAGAGTATGTTGCAGAAGAAATTTGTGTGGCTGCTTCTAAAGCTTGTGGTATTACGCCTGTGTATCATAATATGTTTGCGTTAATGAGTGAAACCGAAAGGATCTGGTACCCACCCAATCATGTCTTCCACATAGACGAGTCAACCAGGCATGACATACTCTACAGGATAAGGTTCTACTTCCCTCATTGGTACTGTAGTGGCAGCAGCAGAACCTACAGATACGGAGTGTCCCGTGGGGCTGAAGCTCCTCTGCTTGATGACTTTGTCATGTCTTACCTTTTTGTTCAGTGGCGGCATGATTTTGTCCACGGATGGATAAAAGTACCTGTGACTCATGAAACTCAGGAAGAGTGTCTTGGGATGGC

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Xilong Wang et al.
International journal of clinical and experimental pathology, 8(5), 5017-5025 (2015-07-21)
MicroRNAs (miRNAs) have emerged as important regulators that potentially play critical roles in cancer cell biological processes. Previous studies have shown that miR-204 plays an important role in various human cancers. However, the underlying mechanisms of this microRNA in breast
Qifan Zheng et al.
Neuro-oncology, 16(9), 1229-1243 (2014-05-28)
As a commonly mutated form of the epidermal growth factor receptor, EGFRvIII strongly promotes glioblastoma (GBM) tumor invasion and progression, but the mechanisms underlying this promotion are not fully understood. Through gene manipulation, we established EGFRvIII-, wild-type EGFR-, and vector-expressing

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique