Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EMU082041

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cdh2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CATCAATGGCAATCAAGTGGAGAACCCCATTGACATTGTCATCAATGTTATTGACATGAATGATAACAGACCTGAGTTTCTGCACCAGGTTTGGAATGGGTCTGTTCCAGAGGGATCAAAGCCTGGGACGTATGTGATGACGGTCACTGCCATTGATGCGGATGATCCAAATGCCCTGAATGGAATGCTGCGGTACAGGATCCTGTCCCAGGCGCCCAGCACACCTTCACCCAACATGTTTACAATCAACAATGAGACTGGGGACATCATCACTGTGGCAGCTGGTCTGGATCGAGAGAAAGTGCAACAGTATACGTTAATAATTCAAGCCACAGACATGGAAGGCAATCCCACTTATGGCCTTTCAAACACAGCCACAGCCGTCATCACGGTGACAGATGTCAATGACAATCCTCCAGAGTTTACTGCCATGACTTTCTACGGAGAAGTCCCTGAGAACAGGGTGGACGTCAT

Numéro d'accès Ensembl | souris

ENSMUSG00000024304

Numéro d'accès NCBI

NM_007664

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... CDH2(12558) , Cdh2(12558)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yu-Huan Tsai et al.
PLoS pathogens, 9(5), e1003381-e1003381 (2013-06-06)
Listeria monocytogenes (Lm) is an invasive foodborne pathogen that leads to severe central nervous system and maternal-fetal infections. Lm ability to actively cross the intestinal barrier is one of its key pathogenic properties. Lm crosses the intestinal epithelium upon the
M-R Lee et al.
Cell death & disease, 5, e1113-e1113 (2014-03-15)
Endoplasmic reticulum (ER) stress is considered one of the pathological mechanisms of idiopathic pulmonary fibrosis (IPF). Therefore, we examined whether an ER stress regulator, Bax inhibitor-1 (BI-1), regulates collagen accumulation, which is both a marker of fibrosis and a pathological
Maorong Jiang et al.
Neurochemical research, 39(11), 2047-2057 (2014-08-15)
Chitosan-based tissue engineered nerve grafts are successfully used for bridging peripheral nerve gaps. The biodegradation products of chitosan are water-dissolvable chitooligosaccharides (COSs), which have been shown to support peripheral nerve regeneration. In this study, we aimed to examine in vitro
Svetlana N Rubtsova et al.
PloS one, 10(7), e0133578-e0133578 (2015-07-25)
Using confocal microscopy, we analyzed the behavior of IAR-6-1, IAR1170, and IAR1162 transformed epithelial cells seeded onto the confluent monolayer of normal IAR-2 epithelial cells. Live-cell imaging of neoplastic cells stably expressing EGFP and of normal epithelial cells stably expressing
Xuebing Yan et al.
Molecular medicine reports, 12(2), 2999-3006 (2015-05-06)
Recent studies have indicated that the epithelial-mesenchymal transition (EMT) is a key molecular mechanism involved in the development of colorectal cancer (CRC). N-cadherin is a mesenchymal marker of the EMT and has been closely linked to several human malignancies. However

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique