Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EMU077571

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cd74

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATGACCCAGGACCATGTGATGCATCTGCTCACGAGGTCTGGACCCCTGGAGTACCCGCAGCTGAAGGGGACCTTCCCAGAGAATCTGAAGCATCTTAAGAACTCCATGGATGGCGTGAACTGGAAGATCTTCGAGAGCTGGATGAAGCAGTGGCTCTTGTTTGAGATGAGCAAGAACTCCCTGGAGGAGAAGAAGCCCACAGAGGCTCCACCTAAAGAGCCACTGGACATGGAAGACCTATCTTCTGGCCTGGGAGTGACCAGGCAGGAACTGGGTCAAGTCACCCTGTGAAGACAGAGGCCAGCTCTGCACAGCAGCAGCGCCCCCTGCTCTCCTGTGCCTCAGCCCTTCTTATGTTCCCTGATGTCACACCCCACTTCCCGTCTCCCTGCACCCTGGGGCTTGAGACTGGTGTCTGTTTCATCGTCCCAGGACACGGCAAATGAAGTC

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Caitlin J Bowen et al.
Developmental biology, 407(1), 145-157 (2015-07-19)
Proper remodeling of the endocardial cushions into thin fibrous valves is essential for gestational progression and long-term function. This process involves dynamic interactions between resident cells and their local environment, much of which is not understood. In this study, we
Yeyou Liang et al.
Metabolism: clinical and experimental, 64(12), 1682-1693 (2015-10-13)
Evidence shows that both macrophage migration inhibitory factor (MIF) and GLUT4 glucose transporter are involved in diabetic cardiomyopathy (DCM), but it remains largely unknown whether and how MIF regulates GLUT4 expression in cardiomyocytes. The present study aims to investigate the
Tomas Baldassarre et al.
Molecular cancer research : MCR, 13(6), 1044-1055 (2015-03-19)
Triple-negative breast cancers (TNBCs) are highly aggressive cancers that lack targeted therapies. However, EGFR is frequently activated in a subset of TNBCs and represents a viable clinical target. Because the endocytic adaptor protein Endophilin A2 (SH3GL1/Endo II) has been implicated
Zheren Shao et al.
PloS one, 10(7), e0132655-e0132655 (2015-07-24)
Melanomas cause over 76% of skin cancer deaths annually. Phosphatidylinositol 3-kinase (PI3K)-AKT-mammalian target of rapamycin (mTOR) signaling pathway is important for melanoma initiation and progression. In the current study, we evaluated the potential anti-melanoma effect of VS-5584, a novel and
Alexandre K Rouquette-Jazdanian et al.
PloS one, 10(6), e0131823-e0131823 (2015-06-30)
Linker for Activation of T cells (LAT) is an adapter protein that is essential for T cell function. Knock-in mice with a LAT mutation impairing calcium flux develop a fatal CD4+ lymphoproliferative disease. miR-155 is a microRNA that is correlated

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique