Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EMU069551

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Col1a1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CACCCTCAAGAGCCTGAGTCAGCAGATTGAGAACATCCGCAGCCCCGAAGGCAGCCGCAAGAACCCTGCCCGCACATGCCGCGACCTCAAGATGTGCCACTCTGACTGGAAGAGCGGAGAGTACTGGATCGACCCTAACCAAGGCTGCAACCTGGACGCCATCAAGGTCTACTGCAACATGGAGACAGGTCAGACCTGTGTGTTCCCTACTCAGCCGTCTGTGCCTCAGAAGAACTGGTACATCAGCCCGAACCCCAAGGAAAAGAAGCACGTCTGGTTTGGAGAGAGCATGACCGATGGATTCCCGTTCGAGTACGGAAGCGAGGGCTCCGACCCCGCCGATGTCGCTATCCAGCTGACCTTCCTGCGCCTAATGTCCACCGAGGCCTCCCAGAACATCACCTATCACTGCAAGAACAGCGTAGC

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Gennaro Di Maro et al.
The Journal of clinical endocrinology and metabolism, 99(9), E1617-E1626 (2014-05-23)
Anaplastic thyroid carcinoma (ATC) is one of the most aggressive human tumors. Twist1 is a basic helix-loop-helix transcription factor involved in cancer development and progression. We showed that Twist1 affects thyroid cancer cell survival and motility. We aimed to identify
Catherine M Willis et al.
PloS one, 9(8), e103966-e103966 (2014-08-05)
Expression of the glycosaminoglycan chondroitin sulfate-E (CS-E) is misregulated in many human cancers, including breast cancer. Cell-surface associated CS-E has been shown to have pro-tumorigenic functions, and pharmacological treatment with exogenous CS-E has been proposed to interfere with tumor progression

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique