Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EMU065331

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Dcn

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AGGCATTCAAACCTCTCGTGAAGTTGGAAAGGCTTTACCTGTCTAAGAACCAACTAAAGGAACTGCCTGAAAAAATGCCCAGAACTCTCCAGGAACTTCGTGTCCATGAGAATGAGATCACCAAGCTGCGGAAATCCGACTTCAATGGACTGAACAATGTGCTTGTCATAGAACTGGGCGGCAACCCACTGAAAAACTCTGGGATTGAAAACGGAGCCTTCCAGGGACTGAAGAGTCTCTCATACATTCGCATCTCAGACACCAACATAACTGCGATCCCTCAAGGTCTGCCTACTTCTCTCACTGAAGTGCATCTAGATGGCAACAAGATCACCAAGGTTGATGCACCCAGCCTGAAAGGACTGATTAATTTGTCTAAACTGGGATTGAGCTTCAACAGCATCACCGTTATGG

Numéro d'accès Ensembl | souris

ENSMUSG00000019929

Numéro d'accès NCBI

NM_007833

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... DCN(13179) , Dcn(13179)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yoshihiro Joshua Ono et al.
The Journal of endocrinology, 223(2), 203-216 (2014-09-24)
Dienogest, a synthetic progestin, has been shown to be effective against endometriosis, although it is still unclear as to how it affects the ectopic endometrial cells. Decorin has been shown to be a powerful endogenous tumor repressor acting in a
Agnes D Berendsen et al.
Matrix biology : journal of the International Society for Matrix Biology, 35, 223-231 (2014-01-01)
Matrix proteoglycans such as biglycan (Bgn) dominate skeletal tissue and yet its exact role in regulating bone function is still unclear. In this paper we describe the potential role of (Bgn) in the fracture healing process. We hypothesized that Bgn

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique