Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EMU052371

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Syt1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GGGGAAAAGAAGCCTTTCTGCGTCTGCCCACATAGTGCTCTTTAGCCAGTATCTGTAAATACCTCAGTAATATGGGTCCTTTCAGTTTCCAGCCATGCATTCCTGATACAATCCAGTGGTACTTCAGATCCTGTTTTAATTTGCACAAATTTAAGTGTAGAAAGCCCCTATGCCCTTCATCATACCACTGCCCTCCAAATCTACTCTTCTTTTAAGCAATATGATGTGTAGATAGAGCATGACTGAAATGTATTGTATCACACCGTTGTATATACCAGTATGCTAAAGATTTATTTCTAGTTTGTGTATTTGTATGTTGTAAGCGTTTCCTAATCTGTGTATATCTAGATGTTTTTAATAAGATGTTCTATTTTAAACTATGTAAATTGACTGAGATATAGGAGAACTGATAATATATTATATGGTAAATATAGTATCGTCTGCATTCCAGCA

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Changping Gu et al.
Shock (Augusta, Ga.), 44(1), 83-89 (2015-03-24)
Recombinant human annexin A5 (Anx5) is known to protect cardiac function during endotoxemia, although the underlying mechanisms have yet to be elucidated. In this study, we demonstrated that Anx5 could repair the disrupted cardiomyocyte adherens junctions and improve the myocardial
Hirokuni Akahori et al.
Nature communications, 6, 7792-7792 (2015-08-06)
Macrophages are an essential component of the immune response to ischaemic injury and play an important role in promoting inflammation and its resolution, which is necessary for tissue repair. The type I transmembrane glycoprotein CD163 is exclusively expressed on macrophages
Y Loriot et al.
Cell death & disease, 5, e1423-e1423 (2014-09-19)
Radiotherapy has a critical role in the treatment of small-cell lung cancer (SCLC). The effectiveness of radiation in SCLC remains limited as resistance results from defects in apoptosis. In the current study, we investigated whether using the Bcl-2/Bcl-XL inhibitor S44563

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique