Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EMU044471

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cd19

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGGGTCCCAGTCCTATGAAGATATGAGAGGGATCCTCTATGCAGCTCCTCAGCTCCACTCAATTCAGTCCGGTCCCAGTCATGAAGAAGATGCAGACTCTTATGAAAACATGGATAAGTCTGACGACCTAGAACCAGCATGGGAAGGAGAGGGCCACATGGGGACTTGGGGAACCACGTGACTCCCAAGTGACTAGCCTGGACTTCGTTAGGTCCCAAGAACCACATCTGATTCTGAAATCTGGAGATCCCAGATGGTGTCAGTCAGTGAAATGACCTTGATCAGGATGTGTGCTAGCTGACACACACACACTCATATGCATGTTCAAGCAAAGCTTCCTTTTGACCCTTTGCTTTCCCCAAATAAACCCAATTAGCCACTCAAATTCTCTGAAGCCGGCCCTTGTGTGGGATAGGAAGATGGGGTTGAATCCAGCCCTGAGTCACCCAGAGGAAGGAGAACTGAGGTCTGAGTACATCCTGGCTCTAGCCTTCCCATGGCCTGGCATTTAGCCACCTAACATCCAGTGATGCAAATATGTCCAGCCGCTACATTCCATGGTGTCCC

Numéro d'accès Ensembl | souris

ENSMUSG00000030724

Numéro d'accès NCBI

NM_009844

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... CD19(12478) , Cd19(12478)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Mauricio Menacho-Márquez et al.
PLoS biology, 11(7), e1001615-e1001615 (2013-08-13)
The catalytic activity of GDP/GTP exchange factors (GEFs) is considered critical to maintain the typically high activity of Rho GTPases found in cancer cells. However, the large number of them has made it difficult to pinpoint those playing proactive, nonredundant
Areumnuri Kim et al.
Oncotarget, 6(35), 38225-38238 (2015-10-31)
Although proteasome inhibition with bortezomib (BTZ) is a validated treatment for relapsed or refractory mantle cell lymphoma (MCL), many patients show resistance to BTZ. However, the molecular mechanism of BTZ resistance in MCL has not been elucidated. In the present
Tai Kiuchi et al.
Science signaling, 7(339), ra78-ra78 (2014-08-21)
The epidermal growth factor receptor (EGFR) is a member of the ErbB family that can promote the migration and proliferation of breast cancer cells. Therapies that target EGFR can promote the dimerization of EGFR with other ErbB receptors, which is

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique