Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EMU041761

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nod1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CCTTGCTTTAGCCGTCTCACGGTTATCAGACTCAGCGTCAACCAGATCACCGACACGGGGGTGAAGGTGCTATGTGAGGAACTGACCAAGTATAAGATCGTGACGTTCCTGGGTTTATACAACAACCAGATAACTGATATCGGAGCCAGGTATGTGGCCCAAATCCTGGATGAATGCAGAGGCCTCAAGCACCTTAAACTAGGGAAAAACAGAATAACAAGTGAGGGCGGGAAGTGTGTGGCTTTGGCTGTGAAGAACAGCACCTCCATCGTTGATGTTGGGATGTGGGGTAATCAGATTGGAGACGAAGGGGCAAAGGCCTTCGCAGAGGCATTGAAGGACCACCCCAGCCTGACCACTCTCAGTCTTGCATTCAATGGCATCTCTCCGGAGGGAGGGAAGAGCCTTGCGCAGGCCCTGAAGCAGAACACCACACTGACAGTAATCTGGCTGACCAAAAATGAACTTAATGATGAGTCTGCAGAGTGCTTCGCTGAGATGCTGAGAGTGAACCAGACGCTACGGCATTTAT

Numéro d'accès Ensembl | souris

ENSMUSG00000038058

Numéro d'accès NCBI

NM_172729

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... NOD1(107607) , Nod1(107607)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

M Wan et al.
Molecular oral microbiology, 30(5), 399-410 (2015-05-06)
Porphyromonas gingivalis, an important periodontal pathogen, has been proved to actively invade cells, induce endothelial cell activation, and promote development of atherosclerosis. Innate immune surveillance, which includes the activity of nucleotide-binding oligomerization domain (NOD)-like receptors (NLRs) and Toll-like receptors (TLRs)
Yuting Zhang et al.
Experimental eye research, 127, 170-178 (2014-08-12)
Fungal keratitis is a serious vision-threatening disease caused by fungi after corneal epithelium damage. We have previously shown a role of cell surface TLRs in Aspergillus fumigatus (A. fumigatus) keratitis. In the present study we showed that Human telomerase-immortalized corneal epithelial

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique