Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EMU033531

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Gabpa

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGCAGTGTTCTTTGGATGCTCATGAAATTTGCCTGCAAGATATTCAGCTGGATCCAGACCGAAGCTTGTTTGATCAAGGAGTGAAAACAGATGGGACTGTACAGCTTAGTGTACAGGTAATTTCTTACCAAGGAATGGAGCCAAAGTTGAACATTCTTGAAATTGTTAAGACTGCGGAAACGGTCGAGGTGGTCATCGATCCAGATGCCCACCACGCGGAAGCAGAAGCGCATCTCGTTGAAGAAGCTCAAGTGATAACTCTTGACGGCACCAAGCACATTACGACCATTTCAGACGAGACCTCGGAGCAGGTGACGAGATGGGCTGCTGCACTGGAAGGCTACAGAAAAGAGCAGGAGCGCCTTGGCATCCCCTATGATCCTATACACTGGTCCACGGACCAAGTCCTGCATTGGGTGGTTTGGGTAATGAAGGAGTTCAGCATGACTGATATAGACCTCACCACACTCAACATTTCGG

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Laura Gambari et al.
Pharmacological research, 87, 99-112 (2014-07-08)
Hydrogen sulfide (H2S), which recently emerged as a potent regulator of tissues and organs, is broadly produced in mammalian cells but whether it can regulate bone cell function is still elusive. The main objective of this study was to establish
Bo-hyun Choi et al.
PloS one, 9(9), e107158-e107158 (2014-09-17)
Photodynamic therapy (PDT) has emerged as an effective treatment for various solid tumors. The transcription factor NRF2 is known to protect against oxidative and electrophilic stress; however, its constitutive activity in cancer confers resistance to anti-cancer drugs. In the present
Hitoshi Murata et al.
PloS one, 10(11), e0142438-e0142438 (2015-11-12)
Mutations of the PTEN-induced putative kinase 1 (PINK1) gene are a cause of autosomal recessive forms of Parkinson's disease. Recent studies have revealed that PINK1 is an essential factor for controlling mitochondrial quality, and that it protects cells from oxidative

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique