Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Key Documents

EMU023701

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Nox4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGGAAGAACCCAAGTTCCAAGCTCATTTCCCACAGACCTGGATTTGGATTTCTGGACCTTTGTGCCTTTATTGTGCGGAGAGACTTTACCGATGCATCAGGAGCAACAAACCTGTCACCATCATCTCAGTCATCAATCATCCCTCTGATGTAATGGAACTCCGTATGATCAAAGAAAACTTTAAAGCAAGACCTGGCCAGTATATTATTCTCCATTGCCCCAGTGTATCAGCATTAGAAAACCACCCATTTACTCTCACAATGTGTCCTACTGAAACCAAAGCAACATTTGGTGTCCACTTTAAAGTAGTAGGAGACTGGACAGAACGATTCCGGGATTTGCTACTGCCTCCATCAAGTCAAGACTCTGAGATTCTGCCCTTCATTCACTCTAGAAATTACCCTAAGTTATACATTGATGGTCCATTTGGAAGCCCATTTGAGGAGTCA

Numéro d'accès Ensembl | souris

ENSMUSG00000030562

Numéro d'accès NCBI

NM_015760

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

mouse ... NOX4(50490) , Nox4(50490)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Aleksandr E Vendrov et al.
Antioxidants & redox signaling, 23(18), 1389-1409 (2015-06-10)
Increased oxidative stress and vascular inflammation are implicated in increased cardiovascular disease (CVD) incidence with age. We and others demonstrated that NOX1/2 NADPH oxidase inhibition, by genetic deletion of p47phox, in Apoe(-/-) mice decreases vascular reactive oxygen species (ROS) generation
Motoya Tanaka et al.
Oncology reports, 34(4), 1726-1732 (2015-08-05)
Malignant pleural mesothelioma (MPM) is an aggressive tumor that is characterized by dysregulated growth and resistance to apoptosis. Reactive oxygen species (ROS)-generating NADPH oxidase (Nox) family enzymes have been suggested to be involved in neoplastic proliferation. Both the antioxidant N-acetylcysteine
Jin-Ran Chen et al.
The Journal of biological chemistry, 290(23), 14692-14704 (2015-04-30)
Bone remodeling is age-dependently regulated and changes dramatically during the course of development. Progressive accumulation of reactive oxygen species (ROS) has been suspected to be the leading cause of many inflammatory and degenerative diseases, as well as an important factor
Qian Jiang et al.
PloS one, 9(9), e107135-e107135 (2014-09-10)
Our previous studies demonstrated that bone morphogenetic protein 4 (BMP4) mediated, elevated expression of canonical transient receptor potential (TRPC) largely accounts for the enhanced proliferation in pulmonary arterial smooth muscle cells (PASMCs). In the present study, we sought to determine
Cheng-Chang Yeh et al.
Clinical oral investigations, 19(6), 1463-1471 (2014-12-04)
Triethylene glycol dimethacrylate (TEGDMA) is a common component of resin-based dental composites and endodontic sealers. TEGDMA induces apoptosis in several types of cells. However, the mechanisms are not completely understood. The aim of this study was to investigate the mechanisms
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique