Accéder au contenu
MilliporeSigma
Toutes les photos(1)

Principaux documents

EMU017111

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Pgp

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGACCCACACTTCAGCTACATGAAGCTCACCAAGGCCGTGCGGTACCTGCAGCAGCCCGACTGTCTGCTCGTGGGCACCAACATGGACAACCGGCTCCCGCTAGAGAACGGCCGTTTCATTGCGGGTACCGGCTGTCTGGTGCGAGCCGTGGAGATGGCCGCCCAGCGCCAGGCGGACATCATCGGGAAGCCTAGCCGCTTCATCTTCGACTGCGTGTCCCAGGAGTATGGTATCAACCCGGAGCGCACCGTCATGGTGGGAGACCGCCTGGACACAGACATCCTCCTGGGCTCCACCTGTAGCCTGAAGACTATCCTGACCCTCACCGGAGTCTCCAGTCTTGAGGATGTGAAGAGCAATCAGGAAAGTGACTGCATGTTCAAGAAGAAAATGGTCCCTGACTTCTATGTTGACAGCATTGCCGACCTCTT

Numéro d'accès Ensembl | souris

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hui-Hui Guo et al.
Nature communications, 10(1), 1981-1981 (2019-05-02)
Cardiovascular and metabolic disease (CMD) remains a main cause of premature death worldwide. Berberine (BBR), a lipid-lowering botanic compound with diversified potency against metabolic disorders, is a promising candidate for ameliorating CMD. The liver is the target of BBR so
Hong Yang et al.
Biomaterials science, 6(9), 2426-2439 (2018-07-25)
The efficacy of cancer chemotherapy can be generally restrained by the multiple drug resistance (MDR) of tumors, which is typically attributed to the upregulation of ATP-binding cassette (ABC) transporter proteins, such as P-glycoprotein (P-gp). There is an urgent need to
Qian Liu et al.
Aging, 12(4), 3713-3729 (2020-02-29)
P-glycoprotein (P-gp) and βIII-tubulin overexpression-mediated drug resistance leads to clinical therapy failure for paclitaxel. However, the development of paclitaxel-resistance reversal agents has not had much success. In this study, EM-E-11-4, a lathyrane-type diterpenoid extracted from Euphorbia micractina, demonstrated good anti-MDR
Anting Jin et al.
Bioactive materials, 5(3), 522-541 (2020-04-24)
Inspired by the mechanism of mussel adhesion, polydopamine (PDA), a versatile polymer for surface modification has been discovered. Owing to its unique properties like extraordinary adhesiveness, excellent biocompatibility, mild synthesis requirements, as well as distinctive drug loading approach, strong photothermal
Nadejda Sigal et al.
Infection and immunity, 83(6), 2358-2368 (2015-04-01)
Human multidrug efflux transporters are known for their ability to extrude antibiotics and toxic compounds out of cells, yet accumulating data indicate they have additional functions in diverse physiological processes not related to drug efflux. Here, we show that the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique